ID: 1031412491

View in Genome Browser
Species Human (GRCh38)
Location 7:121456739-121456761
Sequence GTGGGTCTAGAAATGCATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031412488_1031412491 -8 Left 1031412488 7:121456724-121456746 CCTTTCTGGCCCAGAGTGGGTCT No data
Right 1031412491 7:121456739-121456761 GTGGGTCTAGAAATGCATCCAGG No data
1031412479_1031412491 30 Left 1031412479 7:121456686-121456708 CCTACAGGCCTGAGTCTCTGTCT No data
Right 1031412491 7:121456739-121456761 GTGGGTCTAGAAATGCATCCAGG No data
1031412482_1031412491 22 Left 1031412482 7:121456694-121456716 CCTGAGTCTCTGTCTTCAGGGAA No data
Right 1031412491 7:121456739-121456761 GTGGGTCTAGAAATGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031412491 Original CRISPR GTGGGTCTAGAAATGCATCC AGG Intergenic
No off target data available for this crispr