ID: 1031421342

View in Genome Browser
Species Human (GRCh38)
Location 7:121555739-121555761
Sequence TATAATAGGCCTGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031421342_1031421351 16 Left 1031421342 7:121555739-121555761 CCATCCTCCTCAGGCCTATTATA No data
Right 1031421351 7:121555778-121555800 TCCATGGAAATAACTTAATCTGG No data
1031421342_1031421349 0 Left 1031421342 7:121555739-121555761 CCATCCTCCTCAGGCCTATTATA No data
Right 1031421349 7:121555762-121555784 GCCTTCAGGGGAAGCTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031421342 Original CRISPR TATAATAGGCCTGAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr