ID: 1031423669

View in Genome Browser
Species Human (GRCh38)
Location 7:121580257-121580279
Sequence CAGTGGAAGCCTCAGTGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031423669_1031423672 -2 Left 1031423669 7:121580257-121580279 CCTCTTCACTGAGGCTTCCACTG No data
Right 1031423672 7:121580278-121580300 TGGTCACTCTCTCCTGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031423669 Original CRISPR CAGTGGAAGCCTCAGTGAAG AGG (reversed) Intergenic
No off target data available for this crispr