ID: 1031423817

View in Genome Browser
Species Human (GRCh38)
Location 7:121581790-121581812
Sequence AGCTAGGGAGCCCCTAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031423812_1031423817 28 Left 1031423812 7:121581739-121581761 CCTCTTTTTCAGAAAGCTTAGTA No data
Right 1031423817 7:121581790-121581812 AGCTAGGGAGCCCCTAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031423817 Original CRISPR AGCTAGGGAGCCCCTAGAGA TGG Intergenic
No off target data available for this crispr