ID: 1031426382

View in Genome Browser
Species Human (GRCh38)
Location 7:121610487-121610509
Sequence TTTCTATTCTGATCAAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031426382_1031426384 0 Left 1031426382 7:121610487-121610509 CCCAGGTTTGATCAGAATAGAAA No data
Right 1031426384 7:121610510-121610532 TGCTGAAAGCTTATGTTCTCTGG No data
1031426382_1031426386 27 Left 1031426382 7:121610487-121610509 CCCAGGTTTGATCAGAATAGAAA No data
Right 1031426386 7:121610537-121610559 AACACTTAGCCACTGCTGATTGG No data
1031426382_1031426385 1 Left 1031426382 7:121610487-121610509 CCCAGGTTTGATCAGAATAGAAA No data
Right 1031426385 7:121610511-121610533 GCTGAAAGCTTATGTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031426382 Original CRISPR TTTCTATTCTGATCAAACCT GGG (reversed) Intergenic
No off target data available for this crispr