ID: 1031427306

View in Genome Browser
Species Human (GRCh38)
Location 7:121621347-121621369
Sequence AGGACGGAGATGGGCAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031427306_1031427310 -7 Left 1031427306 7:121621347-121621369 CCAGAACTGCCCATCTCCGTCCT No data
Right 1031427310 7:121621363-121621385 CCGTCCTCCCTCTGCACAGCTGG No data
1031427306_1031427319 30 Left 1031427306 7:121621347-121621369 CCAGAACTGCCCATCTCCGTCCT No data
Right 1031427319 7:121621400-121621422 CTTAAACCATCTGTGCTTGGTGG No data
1031427306_1031427316 27 Left 1031427306 7:121621347-121621369 CCAGAACTGCCCATCTCCGTCCT No data
Right 1031427316 7:121621397-121621419 ACCCTTAAACCATCTGTGCTTGG No data
1031427306_1031427311 -6 Left 1031427306 7:121621347-121621369 CCAGAACTGCCCATCTCCGTCCT No data
Right 1031427311 7:121621364-121621386 CGTCCTCCCTCTGCACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031427306 Original CRISPR AGGACGGAGATGGGCAGTTC TGG (reversed) Intergenic
No off target data available for this crispr