ID: 1031427309

View in Genome Browser
Species Human (GRCh38)
Location 7:121621363-121621385
Sequence CCAGCTGTGCAGAGGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031427309_1031427319 14 Left 1031427309 7:121621363-121621385 CCGTCCTCCCTCTGCACAGCTGG No data
Right 1031427319 7:121621400-121621422 CTTAAACCATCTGTGCTTGGTGG No data
1031427309_1031427316 11 Left 1031427309 7:121621363-121621385 CCGTCCTCCCTCTGCACAGCTGG No data
Right 1031427316 7:121621397-121621419 ACCCTTAAACCATCTGTGCTTGG No data
1031427309_1031427320 19 Left 1031427309 7:121621363-121621385 CCGTCCTCCCTCTGCACAGCTGG No data
Right 1031427320 7:121621405-121621427 ACCATCTGTGCTTGGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031427309 Original CRISPR CCAGCTGTGCAGAGGGAGGA CGG (reversed) Intergenic
No off target data available for this crispr