ID: 1031427312

View in Genome Browser
Species Human (GRCh38)
Location 7:121621367-121621389
Sequence AGGCCCAGCTGTGCAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031427312_1031427319 10 Left 1031427312 7:121621367-121621389 CCTCCCTCTGCACAGCTGGGCCT No data
Right 1031427319 7:121621400-121621422 CTTAAACCATCTGTGCTTGGTGG No data
1031427312_1031427316 7 Left 1031427312 7:121621367-121621389 CCTCCCTCTGCACAGCTGGGCCT No data
Right 1031427316 7:121621397-121621419 ACCCTTAAACCATCTGTGCTTGG No data
1031427312_1031427320 15 Left 1031427312 7:121621367-121621389 CCTCCCTCTGCACAGCTGGGCCT No data
Right 1031427320 7:121621405-121621427 ACCATCTGTGCTTGGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031427312 Original CRISPR AGGCCCAGCTGTGCAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr