ID: 1031427314

View in Genome Browser
Species Human (GRCh38)
Location 7:121621371-121621393
Sequence GCTCAGGCCCAGCTGTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031427314_1031427320 11 Left 1031427314 7:121621371-121621393 CCTCTGCACAGCTGGGCCTGAGC No data
Right 1031427320 7:121621405-121621427 ACCATCTGTGCTTGGTGGCCTGG No data
1031427314_1031427319 6 Left 1031427314 7:121621371-121621393 CCTCTGCACAGCTGGGCCTGAGC No data
Right 1031427319 7:121621400-121621422 CTTAAACCATCTGTGCTTGGTGG No data
1031427314_1031427316 3 Left 1031427314 7:121621371-121621393 CCTCTGCACAGCTGGGCCTGAGC No data
Right 1031427316 7:121621397-121621419 ACCCTTAAACCATCTGTGCTTGG No data
1031427314_1031427322 27 Left 1031427314 7:121621371-121621393 CCTCTGCACAGCTGGGCCTGAGC No data
Right 1031427322 7:121621421-121621443 GGCCTGGAATCTAGAAAGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031427314 Original CRISPR GCTCAGGCCCAGCTGTGCAG AGG (reversed) Intergenic
No off target data available for this crispr