ID: 1031427319

View in Genome Browser
Species Human (GRCh38)
Location 7:121621400-121621422
Sequence CTTAAACCATCTGTGCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031427308_1031427319 20 Left 1031427308 7:121621357-121621379 CCATCTCCGTCCTCCCTCTGCAC No data
Right 1031427319 7:121621400-121621422 CTTAAACCATCTGTGCTTGGTGG No data
1031427314_1031427319 6 Left 1031427314 7:121621371-121621393 CCTCTGCACAGCTGGGCCTGAGC No data
Right 1031427319 7:121621400-121621422 CTTAAACCATCTGTGCTTGGTGG No data
1031427313_1031427319 7 Left 1031427313 7:121621370-121621392 CCCTCTGCACAGCTGGGCCTGAG No data
Right 1031427319 7:121621400-121621422 CTTAAACCATCTGTGCTTGGTGG No data
1031427306_1031427319 30 Left 1031427306 7:121621347-121621369 CCAGAACTGCCCATCTCCGTCCT No data
Right 1031427319 7:121621400-121621422 CTTAAACCATCTGTGCTTGGTGG No data
1031427307_1031427319 21 Left 1031427307 7:121621356-121621378 CCCATCTCCGTCCTCCCTCTGCA No data
Right 1031427319 7:121621400-121621422 CTTAAACCATCTGTGCTTGGTGG No data
1031427315_1031427319 -10 Left 1031427315 7:121621387-121621409 CCTGAGCTGCACCCTTAAACCAT No data
Right 1031427319 7:121621400-121621422 CTTAAACCATCTGTGCTTGGTGG No data
1031427312_1031427319 10 Left 1031427312 7:121621367-121621389 CCTCCCTCTGCACAGCTGGGCCT No data
Right 1031427319 7:121621400-121621422 CTTAAACCATCTGTGCTTGGTGG No data
1031427309_1031427319 14 Left 1031427309 7:121621363-121621385 CCGTCCTCCCTCTGCACAGCTGG No data
Right 1031427319 7:121621400-121621422 CTTAAACCATCTGTGCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031427319 Original CRISPR CTTAAACCATCTGTGCTTGG TGG Intergenic
No off target data available for this crispr