ID: 1031429255

View in Genome Browser
Species Human (GRCh38)
Location 7:121646397-121646419
Sequence TTAAAATATCTTGCCAAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031429254_1031429255 -6 Left 1031429254 7:121646380-121646402 CCTTGATAAAATATTTATTAAAA No data
Right 1031429255 7:121646397-121646419 TTAAAATATCTTGCCAAGTTTGG No data
1031429253_1031429255 9 Left 1031429253 7:121646365-121646387 CCATTTGTGTATTTTCCTTGATA No data
Right 1031429255 7:121646397-121646419 TTAAAATATCTTGCCAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031429255 Original CRISPR TTAAAATATCTTGCCAAGTT TGG Intergenic
No off target data available for this crispr