ID: 1031429536

View in Genome Browser
Species Human (GRCh38)
Location 7:121650530-121650552
Sequence CTCTATTAGTACAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031429531_1031429536 9 Left 1031429531 7:121650498-121650520 CCTGCTGCAGGGGTGAAGCCCTC No data
Right 1031429536 7:121650530-121650552 CTCTATTAGTACAGAGCAGAGGG No data
1031429533_1031429536 -10 Left 1031429533 7:121650517-121650539 CCTCACAGAGAACCTCTATTAGT No data
Right 1031429536 7:121650530-121650552 CTCTATTAGTACAGAGCAGAGGG No data
1031429526_1031429536 29 Left 1031429526 7:121650478-121650500 CCTGGATGTCCAGGCAGAAGCCT No data
Right 1031429536 7:121650530-121650552 CTCTATTAGTACAGAGCAGAGGG No data
1031429532_1031429536 -9 Left 1031429532 7:121650516-121650538 CCCTCACAGAGAACCTCTATTAG No data
Right 1031429536 7:121650530-121650552 CTCTATTAGTACAGAGCAGAGGG No data
1031429528_1031429536 20 Left 1031429528 7:121650487-121650509 CCAGGCAGAAGCCTGCTGCAGGG No data
Right 1031429536 7:121650530-121650552 CTCTATTAGTACAGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031429536 Original CRISPR CTCTATTAGTACAGAGCAGA GGG Intergenic
No off target data available for this crispr