ID: 1031434404

View in Genome Browser
Species Human (GRCh38)
Location 7:121714553-121714575
Sequence GAATCACTTTGAACCATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031434404_1031434407 24 Left 1031434404 7:121714553-121714575 CCAGGAATGGTTCAAAGTGATTC No data
Right 1031434407 7:121714600-121714622 ACCCAAGAGTGCAATGTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031434404 Original CRISPR GAATCACTTTGAACCATTCC TGG (reversed) Intergenic
No off target data available for this crispr