ID: 1031440385

View in Genome Browser
Species Human (GRCh38)
Location 7:121787489-121787511
Sequence TTAACTAAGTCCTAAGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031440385_1031440386 -6 Left 1031440385 7:121787489-121787511 CCAGTTACTTAGGACTTAGTTAA No data
Right 1031440386 7:121787506-121787528 AGTTAAATCATATAGAAGCTTGG No data
1031440385_1031440387 27 Left 1031440385 7:121787489-121787511 CCAGTTACTTAGGACTTAGTTAA No data
Right 1031440387 7:121787539-121787561 AAAGTTGAAAACACATTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031440385 Original CRISPR TTAACTAAGTCCTAAGTAAC TGG (reversed) Intergenic
No off target data available for this crispr