ID: 1031441338

View in Genome Browser
Species Human (GRCh38)
Location 7:121798319-121798341
Sequence CTGTTGTGCTTAAGCACAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031441336_1031441338 28 Left 1031441336 7:121798268-121798290 CCATTGAAGAGAGGCTGTCTTCA No data
Right 1031441338 7:121798319-121798341 CTGTTGTGCTTAAGCACAATGGG No data
1031441335_1031441338 29 Left 1031441335 7:121798267-121798289 CCCATTGAAGAGAGGCTGTCTTC No data
Right 1031441338 7:121798319-121798341 CTGTTGTGCTTAAGCACAATGGG No data
1031441334_1031441338 30 Left 1031441334 7:121798266-121798288 CCCCATTGAAGAGAGGCTGTCTT No data
Right 1031441338 7:121798319-121798341 CTGTTGTGCTTAAGCACAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031441338 Original CRISPR CTGTTGTGCTTAAGCACAAT GGG Intergenic
No off target data available for this crispr