ID: 1031444017

View in Genome Browser
Species Human (GRCh38)
Location 7:121828731-121828753
Sequence CAGTTGCTCTGTCTTCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031444017_1031444027 23 Left 1031444017 7:121828731-121828753 CCCTGATGAAGACAGAGCAACTG No data
Right 1031444027 7:121828777-121828799 GCAGGCAGTTTCCCTATTTCAGG No data
1031444017_1031444022 -8 Left 1031444017 7:121828731-121828753 CCCTGATGAAGACAGAGCAACTG No data
Right 1031444022 7:121828746-121828768 AGCAACTGCCAAGGGGACTAAGG No data
1031444017_1031444026 5 Left 1031444017 7:121828731-121828753 CCCTGATGAAGACAGAGCAACTG No data
Right 1031444026 7:121828759-121828781 GGGACTAAGGAAAGGGTTGCAGG No data
1031444017_1031444023 -3 Left 1031444017 7:121828731-121828753 CCCTGATGAAGACAGAGCAACTG No data
Right 1031444023 7:121828751-121828773 CTGCCAAGGGGACTAAGGAAAGG No data
1031444017_1031444024 -2 Left 1031444017 7:121828731-121828753 CCCTGATGAAGACAGAGCAACTG No data
Right 1031444024 7:121828752-121828774 TGCCAAGGGGACTAAGGAAAGGG No data
1031444017_1031444028 24 Left 1031444017 7:121828731-121828753 CCCTGATGAAGACAGAGCAACTG No data
Right 1031444028 7:121828778-121828800 CAGGCAGTTTCCCTATTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031444017 Original CRISPR CAGTTGCTCTGTCTTCATCA GGG (reversed) Intergenic
No off target data available for this crispr