ID: 1031444018

View in Genome Browser
Species Human (GRCh38)
Location 7:121828732-121828754
Sequence GCAGTTGCTCTGTCTTCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031444018_1031444022 -9 Left 1031444018 7:121828732-121828754 CCTGATGAAGACAGAGCAACTGC No data
Right 1031444022 7:121828746-121828768 AGCAACTGCCAAGGGGACTAAGG No data
1031444018_1031444024 -3 Left 1031444018 7:121828732-121828754 CCTGATGAAGACAGAGCAACTGC No data
Right 1031444024 7:121828752-121828774 TGCCAAGGGGACTAAGGAAAGGG No data
1031444018_1031444027 22 Left 1031444018 7:121828732-121828754 CCTGATGAAGACAGAGCAACTGC No data
Right 1031444027 7:121828777-121828799 GCAGGCAGTTTCCCTATTTCAGG No data
1031444018_1031444026 4 Left 1031444018 7:121828732-121828754 CCTGATGAAGACAGAGCAACTGC No data
Right 1031444026 7:121828759-121828781 GGGACTAAGGAAAGGGTTGCAGG No data
1031444018_1031444028 23 Left 1031444018 7:121828732-121828754 CCTGATGAAGACAGAGCAACTGC No data
Right 1031444028 7:121828778-121828800 CAGGCAGTTTCCCTATTTCAGGG No data
1031444018_1031444023 -4 Left 1031444018 7:121828732-121828754 CCTGATGAAGACAGAGCAACTGC No data
Right 1031444023 7:121828751-121828773 CTGCCAAGGGGACTAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031444018 Original CRISPR GCAGTTGCTCTGTCTTCATC AGG (reversed) Intergenic