ID: 1031444025

View in Genome Browser
Species Human (GRCh38)
Location 7:121828754-121828776
Sequence AACCCTTTCCTTAGTCCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031444025_1031444027 0 Left 1031444025 7:121828754-121828776 CCAAGGGGACTAAGGAAAGGGTT No data
Right 1031444027 7:121828777-121828799 GCAGGCAGTTTCCCTATTTCAGG No data
1031444025_1031444028 1 Left 1031444025 7:121828754-121828776 CCAAGGGGACTAAGGAAAGGGTT No data
Right 1031444028 7:121828778-121828800 CAGGCAGTTTCCCTATTTCAGGG No data
1031444025_1031444031 19 Left 1031444025 7:121828754-121828776 CCAAGGGGACTAAGGAAAGGGTT No data
Right 1031444031 7:121828796-121828818 CAGGGAAACGACGAGAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031444025 Original CRISPR AACCCTTTCCTTAGTCCCCT TGG (reversed) Intergenic