ID: 1031444027

View in Genome Browser
Species Human (GRCh38)
Location 7:121828777-121828799
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031444017_1031444027 23 Left 1031444017 7:121828731-121828753 CCCTGATGAAGACAGAGCAACTG No data
Right 1031444027 7:121828777-121828799 GCAGGCAGTTTCCCTATTTCAGG No data
1031444018_1031444027 22 Left 1031444018 7:121828732-121828754 CCTGATGAAGACAGAGCAACTGC No data
Right 1031444027 7:121828777-121828799 GCAGGCAGTTTCCCTATTTCAGG No data
1031444025_1031444027 0 Left 1031444025 7:121828754-121828776 CCAAGGGGACTAAGGAAAGGGTT No data
Right 1031444027 7:121828777-121828799 GCAGGCAGTTTCCCTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031444027 Original CRISPR GCAGGCAGTTTCCCTATTTC AGG Intergenic