ID: 1031444031

View in Genome Browser
Species Human (GRCh38)
Location 7:121828796-121828818
Sequence CAGGGAAACGACGAGAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031444025_1031444031 19 Left 1031444025 7:121828754-121828776 CCAAGGGGACTAAGGAAAGGGTT No data
Right 1031444031 7:121828796-121828818 CAGGGAAACGACGAGAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031444031 Original CRISPR CAGGGAAACGACGAGAGTGC AGG Intergenic
No off target data available for this crispr