ID: 1031444912

View in Genome Browser
Species Human (GRCh38)
Location 7:121841031-121841053
Sequence AAAGCATCCCAAATCCTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031444912_1031444913 3 Left 1031444912 7:121841031-121841053 CCTTACAGGATTTGGGATGCTTT No data
Right 1031444913 7:121841057-121841079 AATCTGACAATCTTAATTCTTGG No data
1031444912_1031444914 4 Left 1031444912 7:121841031-121841053 CCTTACAGGATTTGGGATGCTTT No data
Right 1031444914 7:121841058-121841080 ATCTGACAATCTTAATTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031444912 Original CRISPR AAAGCATCCCAAATCCTGTA AGG (reversed) Intergenic
No off target data available for this crispr