ID: 1031453872

View in Genome Browser
Species Human (GRCh38)
Location 7:121955954-121955976
Sequence GTGAAAGATAGGAGGACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031453872 Original CRISPR GTGAAAGATAGGAGGACTTT GGG Intronic
904556940 1:31371561-31371583 CTGAAAGATAACAGGACTTCAGG + Intronic
908959969 1:69684965-69684987 GTGAAAGATAGGAAGACACAGGG - Intronic
910296808 1:85655264-85655286 GGGAGAGAGAGGAGGATTTTTGG - Intronic
911293923 1:96090218-96090240 GTGGAAGATAGCACCACTTTGGG + Intergenic
911403442 1:97406217-97406239 GTAAGAGATGGGAGGACTTAGGG - Intronic
911608510 1:99935441-99935463 CTGAAAGATAGAAGTAATTTTGG - Intergenic
911739936 1:101376197-101376219 GTGAAAGCGGGGAGGGCTTTAGG + Intergenic
912650032 1:111429801-111429823 TTAAAAGACAGGAGGCCTTTAGG - Intergenic
915364870 1:155309448-155309470 GTGTAAAATAGGATGACTTAAGG + Intronic
915457372 1:156049864-156049886 GTGAAAGATAGTAGGTTGTTTGG - Intronic
916650651 1:166831445-166831467 GTTAAAGCTAGGGGGACTGTTGG + Intergenic
916916730 1:169415359-169415381 ATGAAGGACAGGAGGAATTTGGG - Intronic
919708769 1:200705270-200705292 GTGAAATACAGGAGCATTTTGGG + Intergenic
920145830 1:203860463-203860485 TGGAAAGGTAGGTGGACTTTGGG + Intergenic
920231693 1:204474919-204474941 GTGAAAGGAAGGGGGACTCTAGG - Intronic
921402773 1:214744504-214744526 CTGAAAGATACAATGACTTTGGG - Intergenic
922563158 1:226583661-226583683 GTGACAGAGAGGAGGACTCTAGG - Intronic
1064343007 10:14503428-14503450 TTGAAAGAAAGAATGACTTTTGG + Intergenic
1070374510 10:75816458-75816480 GTGGGAGATAGGATGACTGTGGG + Intronic
1070553799 10:77513014-77513036 GTGACATATTGGAGGAATTTAGG - Intronic
1071485706 10:86100992-86101014 GTGACTGATAGGGGGACTTTTGG + Intronic
1072492815 10:95924507-95924529 GAGAGAGAGAGGAAGACTTTAGG - Intronic
1074434042 10:113418601-113418623 GTGAAAGAAAGAAGGAATATGGG + Intergenic
1074546020 10:114403326-114403348 GTGAAAGACAAGACTACTTTAGG + Intronic
1074612162 10:115032359-115032381 GTCAAAGATCGGATGACTGTAGG + Intergenic
1075097553 10:119482577-119482599 TTGATAGGTAGGAGGAGTTTGGG - Intergenic
1077512275 11:2974284-2974306 GTGAATGATTGAAGGACTGTTGG - Intronic
1078711787 11:13799493-13799515 GTGAAAGATAAGAGGCCAGTGGG + Intergenic
1080560354 11:33457334-33457356 GTCAAAGATAGGAGAAGTTCTGG + Intergenic
1081236806 11:40656303-40656325 GTGAAAAAGAGGAGGAAATTAGG - Intronic
1083059691 11:59856918-59856940 GTAAAAGTTAGGAGGGCATTGGG + Intronic
1090657479 11:128857047-128857069 GTGACAGAGGGGATGACTTTGGG - Intronic
1091241751 11:134057544-134057566 GTGAAAGACATGAGTTCTTTTGG - Intergenic
1091360156 11:134973018-134973040 GTGAAAGATAGGGGGAGGTCAGG + Intergenic
1091889362 12:4040865-4040887 GAGAAAGGTAGTAGTACTTTAGG + Intergenic
1093149201 12:15601801-15601823 GCCACAGATAGGAGGACTCTGGG + Intergenic
1093858553 12:24135567-24135589 CTCTAAGATAGTAGGACTTTGGG - Intergenic
1094096619 12:26712471-26712493 TTGAAGGATAGGTGGGCTTTTGG - Intronic
1094406818 12:30125128-30125150 GTGAAAGGTAGGAGGACTCGAGG + Intergenic
1095122407 12:38435092-38435114 GTATAAGCTAGCAGGACTTTGGG - Intergenic
1099103171 12:78468247-78468269 GTGAAAGATAAGAGGTTTTGGGG + Intergenic
1101529378 12:105560162-105560184 CTGAAAAATAGAAGGACTCTAGG + Intergenic
1101638643 12:106568764-106568786 GGGAAAGATTGGAGAAATTTTGG + Intronic
1102062202 12:109941486-109941508 GTGAAAGATAAGAAGGGTTTTGG - Intronic
1102682791 12:114702047-114702069 TTGAGAGACAGGAGGACTCTGGG - Intergenic
1105996684 13:25679132-25679154 GTAAAAGATAGTAGGATTCTGGG + Intronic
1106095398 13:26638981-26639003 GTGGAAAATAGGAGGACAGTGGG - Intronic
1108648540 13:52453412-52453434 CTGAAAGTTAGGAGGACAATGGG - Intergenic
1109262537 13:60161122-60161144 GTGATGGATAGGAGTAATTTAGG - Intronic
1110739832 13:78981760-78981782 GGGAAAAATAGGAGGAGTCTTGG + Intergenic
1111964688 13:94848689-94848711 GTGAGAGATGGGAGGAATTGGGG - Intergenic
1115759893 14:36569440-36569462 GTGAAAGATGGAAGGACTAATGG + Intergenic
1116496045 14:45561829-45561851 GGGAAAGAAAGGAGGAATATAGG - Intergenic
1117407346 14:55417108-55417130 TTTAGACATAGGAGGACTTTAGG + Intronic
1118756899 14:68851524-68851546 ATGAAATATAGGATGACTTACGG + Intergenic
1118857241 14:69633103-69633125 CTCAAATATAGGAGGCCTTTAGG + Intronic
1119648171 14:76363686-76363708 TTGATGGATAAGAGGACTTTAGG - Intronic
1120035239 14:79689498-79689520 GTGAAAGATGGAAGGTCATTTGG - Intronic
1120097542 14:80404984-80405006 GAGAAAGAGAGGAAGATTTTAGG - Intergenic
1122617375 14:103029118-103029140 GTAAAAGATTGAAGGAATTTTGG - Intronic
1124919454 15:34011725-34011747 GAGAAAGATATAAGGACTTAGGG - Intronic
1126178415 15:45761227-45761249 GTGAAAGAAAGGAGGAAGTGAGG - Intergenic
1126197596 15:45949433-45949455 GTGCAAGATAGGTGAACTGTAGG + Intergenic
1130953327 15:88609519-88609541 GTAAAAGAGAGGAGGGGTTTGGG + Intergenic
1131477026 15:92748679-92748701 ATGAAAGTTTGGAAGACTTTGGG + Intronic
1132211311 15:100024695-100024717 GGGATACATAGGAGGACTTTTGG - Intronic
1133494249 16:6301461-6301483 GTGAAAGATTGAAGCATTTTAGG + Intronic
1133682191 16:8130092-8130114 TTCAAAGACAGGAGGACTTAGGG + Intergenic
1138412063 16:56848512-56848534 GTGGAAGATGGGAAGACTTGTGG - Intronic
1138778054 16:59748974-59748996 GTGGAAAATGGGAGGAATTTTGG + Intronic
1141221647 16:82075031-82075053 ATAAAAGATAAGAGGAATTTTGG + Intronic
1143121199 17:4608102-4608124 GGGAAGAACAGGAGGACTTTGGG - Exonic
1143433584 17:6905415-6905437 GTGAAAATCAGGATGACTTTGGG - Intronic
1144358184 17:14466003-14466025 GGGAAAGATAGGAGAACATTAGG - Intergenic
1144465999 17:15498226-15498248 GAGAAAGAGAGGAAGACTTGAGG + Intronic
1147777221 17:42910870-42910892 GTGAGAGATAGGAAGGATTTGGG - Intronic
1148604047 17:48915451-48915473 ATGAAAGAGAGGAGCAATTTTGG + Intronic
1149067364 17:52496298-52496320 GTCAGAGATAGTTGGACTTTAGG - Intergenic
1156905598 18:42348609-42348631 GGGAAAGATGGCAGGACTTCAGG + Intergenic
1158133764 18:54183061-54183083 GTGAAAGATAGGAAGAATCAAGG + Intronic
1158777233 18:60598322-60598344 GAGAAAGATAGGTTGACTTGAGG - Intergenic
1159419724 18:68201851-68201873 GTGAAAGAGTTGAGGAGTTTGGG + Intergenic
1160740580 19:683616-683638 GGGAGAGAAAGGAGGTCTTTTGG + Intergenic
1161095447 19:2387780-2387802 GTGAAGGTCAGGAGCACTTTGGG + Intergenic
1166204167 19:41258168-41258190 GGTAAAGAGAGGATGACTTTGGG + Intronic
925559174 2:5169598-5169620 GAGAGAGAGAGGAAGACTTTTGG + Intergenic
926373343 2:12202755-12202777 TTGAAGGATAGGAGGAGTTTGGG + Intergenic
926619960 2:15038658-15038680 GTGAACAGTAGGAGGACTTCTGG + Intergenic
927277115 2:21271763-21271785 GTGAAAGATAGGAGGCTACTGGG - Intergenic
928319444 2:30271527-30271549 GTGAGAGATAGAAGGGCTTTGGG - Intronic
928871842 2:35989643-35989665 GAGCAAGATAGGAGGGCATTTGG - Intergenic
931162705 2:59711225-59711247 TTCAAAGATATGAAGACTTTGGG - Intergenic
933263639 2:80157244-80157266 GAGAAAGGTAGGAGCATTTTTGG - Intronic
934934460 2:98454605-98454627 GTGAAAAATAAGAGTACTGTGGG - Intronic
935868265 2:107416063-107416085 GTGAAGGTTAGGTGGACTTTTGG - Intergenic
937301631 2:120846281-120846303 GTGAGAGATAGGTGGAGTTCTGG + Intronic
937450820 2:122000935-122000957 GTGAAACATGGGTGGAGTTTTGG + Intergenic
937636874 2:124165936-124165958 GTGAAAGCAATGAGGAGTTTTGG - Intronic
939720001 2:145636730-145636752 GTATAAGACAGCAGGACTTTTGG + Intergenic
941683780 2:168427131-168427153 GAGAAAGGTAGCAGGACTTAAGG + Intergenic
944560904 2:200936503-200936525 GTAAAAGATAGGAAGAATCTGGG + Intronic
945001015 2:205350724-205350746 GTGAAAGAAAAGAGGTCTCTGGG + Intronic
945629284 2:212252330-212252352 CAGAAAGGTAGGAGGAATTTTGG + Intronic
946669362 2:222085896-222085918 GTGAAAGAGAGGAGGTCTTTTGG + Intergenic
948087469 2:235263529-235263551 GTAAAGGAGAGGAGGACTATGGG - Intergenic
1169170108 20:3457985-3458007 GTGATAGTTAGGAGGAGGTTTGG + Intergenic
1170788681 20:19490165-19490187 GTGAAAGATGGGAGGACATGTGG - Intronic
1171277291 20:23868650-23868672 GTGATAGATGTGAGGGCTTTTGG - Intergenic
1171728363 20:28650085-28650107 GTGGATAATAGGAGTACTTTGGG + Intergenic
1176475712 21:7203010-7203032 GTGGATAATAGGAGTACTTTGGG - Intergenic
1179430656 21:41318821-41318843 GTTACAGGTAGGAGGATTTTAGG - Intronic
1181094785 22:20497497-20497519 GTGTAACAGAGGAGGACTTTGGG + Intronic
1182850019 22:33465823-33465845 GTGAGAGAGAGGAGGAATTTGGG - Intronic
1183804564 22:40197229-40197251 GTGCAGAATAGGAGGTCTTTGGG + Intronic
1184177310 22:42795732-42795754 GTCAAAGATGGGAGGACTGAGGG + Intergenic
952984927 3:38770642-38770664 GAGAAAGAAAGCATGACTTTTGG + Intronic
953503477 3:43460445-43460467 GTGGAAGGTAGGAGGACTAAGGG + Intronic
953900360 3:46837409-46837431 ATGAAAGATATAAGGACTGTGGG - Intergenic
959845801 3:111031978-111032000 GTGATATATAGGATGACTCTAGG - Intergenic
960344052 3:116510734-116510756 CTGAATGATAGCAGGAATTTGGG - Intronic
962267707 3:133955390-133955412 GTGAAAGAGAGGTGGAATGTGGG + Intronic
963705318 3:148679768-148679790 GTGGAAGTTAGGAGGACATAGGG - Intergenic
964464555 3:156976748-156976770 GTGAGAGATATAAGAACTTTAGG + Intronic
965510239 3:169560837-169560859 GTTAAAGATAGTAGAATTTTGGG + Intronic
966068886 3:175850497-175850519 GAGAAAGAAAAGAGGACTTCTGG - Intergenic
966611567 3:181873022-181873044 GTGTGAGAAAGGAGCACTTTTGG + Intergenic
966654712 3:182342708-182342730 GTGAAAGAAAGGTAGAATTTTGG + Intergenic
967262872 3:187661417-187661439 GTGGCACATAGGAGGGCTTTAGG + Intergenic
968862590 4:3184579-3184601 GTGAGAGAGAGCAGGGCTTTGGG + Intronic
971744431 4:30560646-30560668 GTGAAGGATAGGAAGACAATGGG + Intergenic
972712436 4:41610796-41610818 GTGCAAGAGAGAAGGAGTTTAGG - Intronic
976140225 4:81983815-81983837 CTAAAAGAGAGGAGGCCTTTTGG + Intronic
976336026 4:83887894-83887916 GTAAAGGATGGGGGGACTTTGGG - Intergenic
976499422 4:85770389-85770411 GTGAACAATAGGAGGACTATTGG - Intronic
978165340 4:105600641-105600663 GAGAAACAAAGGAGGACTTCAGG - Intronic
980264831 4:130501855-130501877 GTGAAAATGAGGAGGACATTAGG - Intergenic
981943720 4:150316396-150316418 CTGAAAGGGAGAAGGACTTTCGG + Intronic
982146199 4:152395847-152395869 GTGAAAAATAGGTGGTCTATGGG + Intronic
982519877 4:156401991-156402013 GTGAAAGATTGGAGACCTTTAGG - Intergenic
984820974 4:183882066-183882088 GTGACAGATACTAGGACTTCAGG + Intronic
987135564 5:14896750-14896772 GTGAAAGAGAAGAGCTCTTTGGG + Intergenic
992935387 5:81698421-81698443 GTTAAAAATAGGATAACTTTTGG - Intronic
993885855 5:93414182-93414204 ATGAAAGATCATAGGACTTTGGG - Intergenic
996838896 5:127824522-127824544 GTGAAAGATTTGGGGAGTTTTGG - Intergenic
998039904 5:138945344-138945366 TTGGAAGACAGGAGGACTTGGGG - Intergenic
998523006 5:142817515-142817537 GTGAAGGATAAGAGGGCTGTTGG + Intronic
999008373 5:148006696-148006718 GAGAGAGAGAGGAGGATTTTAGG - Intergenic
1002312013 5:178320579-178320601 GTGAAAGATTGGGGGGCTTGAGG + Intronic
1003633755 6:7812154-7812176 GAGAAAAATGGAAGGACTTTAGG + Intronic
1005272806 6:24184147-24184169 AGGAAAGATACTAGGACTTTGGG - Intronic
1005313254 6:24579764-24579786 ATCAAAGCTAGGAGGACTTATGG - Intronic
1007014263 6:38447916-38447938 GAGAAAGATACGTGGACATTTGG + Intronic
1008325883 6:50181282-50181304 GTAAAAGAAAAGAGGACTCTGGG + Intergenic
1008600094 6:53084856-53084878 GTCAAAGAGAGGTAGACTTTAGG + Intronic
1008678467 6:53845952-53845974 GTGGAAGATAGGAGATCTTCCGG + Intronic
1013581479 6:111539068-111539090 ATGAAAAATAGGAACACTTTTGG - Intergenic
1014964924 6:127736086-127736108 GTGAAAGAGAGAAGGATGTTTGG + Intronic
1017127581 6:151080275-151080297 GTGAACGATTTGAGGACTTTTGG + Intronic
1020749260 7:12119869-12119891 GTGAAAAATACCATGACTTTAGG + Intergenic
1022677238 7:32511563-32511585 GGGAAAGATAGGAGGACACTTGG + Intronic
1025011060 7:55399110-55399132 TTGAAAGATAGGATGACGCTGGG + Intronic
1026503220 7:70960357-70960379 GGGTGAGATAGGAGGACTCTCGG + Intergenic
1026876714 7:73883452-73883474 GGGAAAGCCAAGAGGACTTTAGG + Intergenic
1029045423 7:97622778-97622800 TTGAAAGATGGGAAGAATTTGGG - Intergenic
1029907107 7:104103205-104103227 GGGAAAGGTAGGAGGGATTTTGG + Intergenic
1030489648 7:110215588-110215610 GGGAAAAATAGGAAGAGTTTGGG - Intergenic
1030914137 7:115291454-115291476 GTTAAAGAAAGGAAGGCTTTGGG + Intergenic
1031346428 7:120672574-120672596 GTGAAAACTAGGGGAACTTTTGG - Intronic
1031453872 7:121955954-121955976 GTGAAAGATAGGAGGACTTTGGG + Intronic
1031520776 7:122762907-122762929 GAGAAAGATAGGAGGTCATTGGG + Intronic
1033648664 7:143323587-143323609 GTGAAAGAGGGGTGGACATTTGG - Intronic
1036226878 8:6966779-6966801 GTGCAAGAAAGGTGGACTTCTGG + Intergenic
1039032932 8:33329301-33329323 GTGAAATATAACAGGACATTTGG + Intergenic
1039913942 8:41845910-41845932 ATGGAAGAAAGCAGGACTTTTGG - Intronic
1041057793 8:54005613-54005635 GTGAAGGAGTGGAGGAATTTAGG - Intronic
1042046201 8:64654872-64654894 GTCAAAGATCAGATGACTTTAGG - Intronic
1042942301 8:74119676-74119698 GTGAAAATTGGGAGAACTTTGGG + Intergenic
1046566633 8:115910382-115910404 GTGCAAGAGAGTAGGACTTCTGG + Intergenic
1047279518 8:123433021-123433043 GTCTAAGATAGAAGGACTATAGG - Intronic
1047925305 8:129676966-129676988 GTGAGAGATAGGATGACTCAAGG + Intergenic
1048000774 8:130377819-130377841 GTGAGAGAGAGGAGGCCTCTGGG - Intronic
1048716409 8:137275521-137275543 TTGAAAGCTGGGAGGACTTCTGG - Intergenic
1053442519 9:38127897-38127919 TTCAAAGCTAGGAGAACTTTAGG - Intergenic
1054992874 9:71350592-71350614 GTGAAATATCTGAGGATTTTAGG - Intronic
1055033125 9:71790716-71790738 GAGAAAGAAAGGAGAACTTTAGG + Intronic
1055161160 9:73129699-73129721 ATGAAAGATTGGAGGACTCCAGG + Intergenic
1056436168 9:86577792-86577814 CTGAAAGACAGCAGGACTCTCGG - Intergenic
1057218466 9:93242848-93242870 GGCAAGGATAGGAGGACATTTGG + Intronic
1061196396 9:129109448-129109470 GTCCAAGAGCGGAGGACTTTTGG + Intronic
1061629155 9:131860721-131860743 TTGATAGGAAGGAGGACTTTGGG - Intronic
1186234043 X:7488113-7488135 GTGAATGATAGGATGCCATTTGG - Intergenic
1187309275 X:18125565-18125587 GTGAAGGGTTGGAGGACATTGGG - Intergenic
1190383400 X:49861400-49861422 CTGAAAGATATGAGGTATTTAGG - Intergenic
1192272015 X:69589691-69589713 GTGCAAGATAGGTGGACAGTTGG - Intergenic
1193894031 X:87088363-87088385 ATGGAAGATAAGAGTACTTTAGG - Intergenic
1193976238 X:88122631-88122653 GTCAAAGATCAGATGACTTTAGG - Intergenic
1194585916 X:95734281-95734303 CTGACACATAGGAGGACTTATGG - Intergenic
1196032936 X:111110849-111110871 CAAAAAGATAGGAGCACTTTTGG + Intronic
1197279431 X:124517867-124517889 GAGAAAAATTGGAGGAATTTTGG + Intronic
1201238196 Y:11931555-11931577 GAGAAAGATTGGAGGACACTAGG + Intergenic