ID: 1031454348

View in Genome Browser
Species Human (GRCh38)
Location 7:121960989-121961011
Sequence TCAGTACCTTTCTTAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031454348 Original CRISPR TCAGTACCTTTCTTAGAGCC TGG (reversed) Intronic
905315405 1:37079651-37079673 TCAGTAATTTTCTTAGAGCAGGG - Intergenic
906945338 1:50289977-50289999 CCAGTGCCTTTCTTGGTGCCAGG + Intergenic
908741818 1:67336719-67336741 CCATTAGCTTTCTCAGAGCCAGG + Intronic
908891533 1:68854328-68854350 TCTGTACTTTTCATAGAGACAGG + Intergenic
910328431 1:86039191-86039213 ACAGTACCATTGTTAGACCCAGG - Intronic
910617298 1:89213303-89213325 TCAGTGCCTTTTTCAGACCCAGG - Intergenic
910778147 1:90896924-90896946 TCAGTTCCTTTTGTAGAGACTGG + Intergenic
911448045 1:98024480-98024502 TCAGTGCCTTGCATAGTGCCCGG + Intergenic
911936799 1:103986600-103986622 TTAGTGCCTTTCTAAGAGGCTGG + Intergenic
913478222 1:119259510-119259532 AAAGTACCTATCTCAGAGCCTGG - Intergenic
917449833 1:175138288-175138310 CCAGTGCCTATCTCAGAGCCTGG + Intronic
920315147 1:205071562-205071584 TCAGAAGCTTGCTTAGGGCCAGG + Intronic
921693932 1:218185115-218185137 TCAGTGACTATCATAGAGCCAGG + Intergenic
923783494 1:237046004-237046026 TCAGGATCATTCTTACAGCCAGG - Intronic
1067523564 10:47025646-47025668 GCTGTGCCTTTCTTAGAGGCTGG + Intergenic
1068557188 10:58472050-58472072 TTAGTATCTTTCCTAGAGACAGG + Intergenic
1071717654 10:88113515-88113537 TCAGGACCTCCCATAGAGCCTGG - Intergenic
1072384996 10:94915548-94915570 TCAGTTTCTTCATTAGAGCCAGG + Intergenic
1072467867 10:95683502-95683524 TCAGTATCCTTTTTAGAGCTGGG - Exonic
1073263467 10:102208143-102208165 TGAGAACTTTTCTGAGAGCCAGG - Intergenic
1073369102 10:102970599-102970621 TCAGTTCCTTTTTTAGAGATAGG + Intronic
1073676459 10:105652474-105652496 TCACTACATTTCTTAGAACTAGG - Intergenic
1074900237 10:117810322-117810344 TCAGAGCCATTCTTAAAGCCAGG + Intergenic
1075605292 10:123801000-123801022 GCAGTACCTTTCTTGGGGCAGGG - Intronic
1076651825 10:131995025-131995047 TCAGTAGCTTTCTTATATGCTGG + Intergenic
1078552445 11:12289961-12289983 TAAGTAACTTGCTCAGAGCCAGG + Intronic
1080223830 11:29937407-29937429 TCGATACCTTTATTAGTGCCTGG - Intergenic
1082118713 11:48355980-48356002 ACAGTAGCATTCCTAGAGCCTGG + Intergenic
1082255613 11:50029327-50029349 ACAGTAGCATTCCTAGAGCCTGG - Intergenic
1084736796 11:71110618-71110640 TCAGGAACTTTCCCAGAGCCTGG - Intronic
1087943602 11:104130671-104130693 TGAATACCCTTCTTAGAGCATGG + Intronic
1089582052 11:119487455-119487477 ACAGTACCTGTCTTAGAGGATGG + Intergenic
1089890399 11:121874976-121874998 TCAAGACCTTTCTAAGGGCCGGG - Intergenic
1090250707 11:125249737-125249759 CCAGTTCCTATCTTAGAACCTGG - Intronic
1092456258 12:8645740-8645762 TTTGTATCTTTCTTAGAGACAGG + Intronic
1094433334 12:30394705-30394727 TCAGTGCCTTTTTTAGATCCAGG - Intergenic
1097661602 12:62436341-62436363 CCAGTAGCTTGCTTAGAGTCTGG - Intergenic
1097846472 12:64371656-64371678 TTTGTATTTTTCTTAGAGCCGGG - Intronic
1099119852 12:78675252-78675274 TCAGTGCCTTTCTTATACCTGGG - Intergenic
1100120468 12:91364019-91364041 TCAGTACTTTCCTTAGTCCCAGG + Intergenic
1104145903 12:126033460-126033482 TCAGTCACGTTATTAGAGCCTGG - Intergenic
1104193244 12:126504173-126504195 TCAGTATCTTGCTTAAAGTCAGG + Intergenic
1104223507 12:126809259-126809281 TCAAAATCTTTCTTAGAGGCTGG - Intergenic
1105043895 12:132986128-132986150 TCAGTACCATCCTCGGAGCCTGG - Intergenic
1106546570 13:30735895-30735917 CCAGTCCCATTTTTAGAGCCAGG + Intronic
1108083388 13:46760384-46760406 AAAGTATCTTTCTTATAGCCTGG - Intergenic
1110052124 13:70916789-70916811 TCACTACCTTTGTCAGAACCAGG + Intergenic
1110227817 13:73138280-73138302 TCAGTGCCTTGCTTAGTGCCAGG + Intergenic
1110274889 13:73632359-73632381 TCAGTACCACTCCTAGACCCAGG + Intergenic
1112032541 13:95470942-95470964 CCAGCACCTATCTCAGAGCCGGG - Intronic
1112996765 13:105584260-105584282 TCAGTGCCTACCATAGAGCCCGG - Intergenic
1117102830 14:52367976-52367998 TCAGTTCCTTTCTGAGTTCCAGG - Intergenic
1118379284 14:65204644-65204666 GCTGAACCTTTCTCAGAGCCGGG - Intergenic
1119566741 14:75635537-75635559 CCAGTGCATTTCTAAGAGCCTGG + Intronic
1119937427 14:78604882-78604904 TCAATAACTTTCTTACAGCATGG + Intronic
1120698562 14:87672289-87672311 CCAGTACCCTTCCTAGTGCCTGG - Intergenic
1122465561 14:101931261-101931283 TCAGTTCCTTTTTTAGAGACAGG + Intergenic
1124367144 15:29080146-29080168 TCAGGTGCTTTCTTTGAGCCAGG + Intronic
1124992542 15:34690176-34690198 TCATTACATTTCTTATAGACAGG + Intergenic
1127887774 15:63218313-63218335 TCAGTACCTATCACAGTGCCTGG + Intronic
1129185853 15:73906006-73906028 CCAGTCCCTTGCTGAGAGCCTGG - Intergenic
1129847813 15:78776076-78776098 TCAGGACACTTCTAAGAGCCAGG + Intronic
1131224606 15:90613329-90613351 TCAGTCACTTACTTAGAGTCTGG + Intronic
1131540546 15:93271539-93271561 TCAGTTTCTTTCTGACAGCCTGG + Intergenic
1131597138 15:93809561-93809583 TCATTTCCTTTCTCTGAGCCAGG + Intergenic
1133128806 16:3663723-3663745 TCAGAGCCTTCCTTAGACCCAGG - Exonic
1141046279 16:80718816-80718838 TCAGTACCTCTTTTAGGGACTGG - Intronic
1145246539 17:21273333-21273355 TCAGCACGTTTCCTAGAGCAGGG - Intergenic
1145789810 17:27619336-27619358 TCAGAACCTTTCTTAGTGTGTGG + Intronic
1146674933 17:34766740-34766762 ACAGGATCTTTCTTTGAGCCTGG - Intergenic
1149384351 17:56126790-56126812 TCAGGACCAATCTTAAAGCCTGG - Intronic
1150635517 17:66910730-66910752 TCAGGCCCTTTGTTAGAGCTGGG + Intergenic
1151379676 17:73717067-73717089 TCACTATCTTTCTTACAGCACGG - Intergenic
1152179919 17:78812975-78812997 TCGGGACTTTTCTTAGAGCCTGG + Exonic
1153613660 18:6912957-6912979 TCAGTATCTTTCCAAGTGCCAGG + Exonic
1155243525 18:23885429-23885451 ACAGTACCATTCTTGGAACCAGG - Intronic
1157530962 18:48419982-48420004 CCAGTACCTTGCATAGTGCCCGG + Intergenic
1157620965 18:49017331-49017353 TCATTACCTTCATTAGAGCCCGG - Intergenic
1161833269 19:6625802-6625824 TCAGTGCCTTTTTCAGACCCAGG + Intergenic
1163640897 19:18461422-18461444 TCAGAACCTGCCTGAGAGCCAGG - Intronic
1164112198 19:22177501-22177523 TTAGTACATCACTTAGAGCCAGG + Intergenic
1165258059 19:34591975-34591997 TCAGGCCCTTTCCCAGAGCCGGG - Intergenic
1166012288 19:39951370-39951392 TCACTACCTTTCTAAGGGCAGGG - Intergenic
1167451536 19:49573013-49573035 TCAGTAAAATGCTTAGAGCCAGG - Intronic
1167742829 19:51334494-51334516 TCACTACCTGTCTGAGAGCCAGG - Intronic
926881100 2:17543984-17544006 TGAGTATCTTTCTGAGTGCCTGG - Intronic
930577628 2:53170996-53171018 TCACTACATTAATTAGAGCCAGG + Intergenic
931088762 2:58863705-58863727 CCAGTACCTGTCATAGTGCCAGG - Intergenic
931893446 2:66702008-66702030 TAAATATTTTTCTTAGAGCCTGG - Intergenic
933283407 2:80357472-80357494 ACAGTGCCTATCATAGAGCCGGG + Intronic
934552904 2:95272936-95272958 TCTGTGACTTTCTCAGAGCCAGG - Intergenic
937524202 2:122747188-122747210 AAAGTACCTTTCTTCGAGGCTGG - Intergenic
937593364 2:123642348-123642370 TCAGTACCTAGCTCAGTGCCTGG + Intergenic
939647081 2:144713520-144713542 TAAGTACCTTTCTTTGTGCTTGG - Intergenic
940343235 2:152602753-152602775 TCAAAACGTTTCTAAGAGCCAGG - Intronic
942282607 2:174381697-174381719 TAAGTACCTTTTTTAGCTCCTGG + Exonic
942544132 2:177044989-177045011 TCAGTGGCCTTCCTAGAGCCTGG - Intergenic
943703120 2:191007386-191007408 TTAGGATCTTTCTTAAAGCCTGG + Intronic
945057988 2:205884786-205884808 TCAGTACCTTTCTGAGACCAAGG - Intergenic
945096604 2:206225595-206225617 TCAGTGCCTTTCTCAGGGCTGGG - Intergenic
1170017927 20:11802943-11802965 TCCTTTCCTTTGTTAGAGCCAGG - Intergenic
1171220048 20:23388027-23388049 TCAATGCCTGTCTTAGAGCCAGG + Intronic
1172314586 20:33943936-33943958 TCAGTACTGTCCTTAGACCCAGG + Intergenic
1173225808 20:41161859-41161881 TCAGTTTCTTTCCTGGAGCCAGG + Intronic
1173370989 20:42435083-42435105 TCAGTACCTTACCTAGTACCTGG - Intronic
1177640349 21:23836708-23836730 TCAATATCTTTCTTAAAGTCTGG + Intergenic
1182552219 22:31106596-31106618 TCAGCCCTTTTCTTAGAGACAGG + Intronic
1184326360 22:43790367-43790389 TCAGTTCCTTTCTAGGAGTCTGG + Intronic
1184541028 22:45124994-45125016 TCATTGCCTTTGTCAGAGCCAGG - Intergenic
1185099329 22:48829124-48829146 TCAGTACCCTCCATAAAGCCAGG - Intronic
952502965 3:33981079-33981101 ACAGTACCTACCTAAGAGCCAGG + Intergenic
953552412 3:43913859-43913881 TCAGTATCTTTCATGGAGCAGGG - Intergenic
953758526 3:45668028-45668050 ACAGTCCCTTACATAGAGCCTGG + Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
955346195 3:58163728-58163750 TCAGTGCATTTCTGGGAGCCTGG - Intronic
958169380 3:89918711-89918733 TCTGTACCTTTTTCAGACCCAGG + Intergenic
963157210 3:142111657-142111679 TTAGGACCTTCCTTAGACCCTGG - Intronic
964709919 3:159660977-159660999 ACAGTACCTTGCATAGTGCCTGG - Intronic
966174493 3:177121038-177121060 ACAATTCCTTTCTAAGAGCCAGG + Intronic
966595828 3:181724070-181724092 TCACTACCTTTCTCAGAGCCTGG - Intergenic
967136950 3:186520654-186520676 TCATTTCCTTTCTTCAAGCCTGG - Intergenic
967337218 3:188358134-188358156 ACAGTACCTTCCTCAGAGGCTGG - Intronic
967641855 3:191874940-191874962 GAAATACCTTTCTTAGAGGCTGG - Intergenic
968873564 4:3253761-3253783 TCAGTACCTTTCTCAGAGGGTGG + Intronic
969891733 4:10266287-10266309 TGAGTACATTACTCAGAGCCAGG - Intergenic
974924843 4:68284724-68284746 TCAGTACCTTATTTTGGGCCTGG - Intergenic
975278712 4:72535117-72535139 TTAATACCATTCTCAGAGCCAGG + Intronic
976128571 4:81859112-81859134 TCAGTGCCCTTCTTTGAGCAAGG + Intronic
977068379 4:92348764-92348786 TCTTTACCTTGCTTAGGGCCTGG - Intronic
979291652 4:118985059-118985081 CCAGTAGGTTTCTTGGAGCCTGG - Intronic
980410804 4:132415314-132415336 TCAGGACCTTTTTCAGACCCAGG + Intergenic
981147147 4:141338554-141338576 TCAGTACCTTTTCCAGACCCAGG - Intergenic
984198167 4:176684896-176684918 TCTGTATTTTTCATAGAGCCAGG + Intronic
984369943 4:178850678-178850700 TCACTACCTTTCTTAGTGTCTGG - Intergenic
986195985 5:5536727-5536749 TCTCTCCCTTTCATAGAGCCTGG - Intergenic
988146847 5:27320335-27320357 TCAGTATCAGTCTTAGACCCAGG + Intergenic
988573742 5:32398459-32398481 TCAGAACCTATCTTAAAGCTTGG - Intronic
988910779 5:35840049-35840071 TCAGTGCCTTTTTCAGACCCAGG + Intergenic
990798980 5:59577973-59577995 CCAGTACATTTCTCAGAGACTGG + Intronic
991189069 5:63847523-63847545 TGAGTAACTTTCCTAGAGCATGG - Intergenic
995024546 5:107404548-107404570 TCAGCACATTTCTTCGAGGCAGG + Intronic
997893231 5:137693736-137693758 TCAGTCACTCTCTCAGAGCCAGG - Intronic
1000568161 5:162877131-162877153 TCAGTGCCTTTTTCAGAACCAGG + Intergenic
1003153973 6:3575710-3575732 TCAGTACCACTCTTTGATCCAGG + Intergenic
1004075748 6:12342772-12342794 TCAGTACCTCCCTTTGACCCTGG + Intergenic
1004381862 6:15139358-15139380 TCTGTATCTTTATTAGAGACGGG + Intergenic
1004541359 6:16553452-16553474 ACAGTACCTTTCTCAGTGCACGG + Intronic
1004727137 6:18322005-18322027 TCAGTACTTTTAATAGAGACGGG + Intergenic
1014354657 6:120390986-120391008 TCATTATCTTTCTTAGAGTGTGG - Intergenic
1017863642 6:158422987-158423009 CCTGTAAGTTTCTTAGAGCCAGG - Intronic
1018094807 6:160376028-160376050 ACATTACCTTTCTGTGAGCCAGG - Intronic
1022059534 7:26778100-26778122 TCATTACAATTCTTATAGCCTGG - Intronic
1025077984 7:55959529-55959551 TAAGTACTTTTCTCAGATCCTGG - Intronic
1025751085 7:64294459-64294481 TCACTATCTTTCTGAGAGCAGGG + Intergenic
1026404635 7:70052344-70052366 ACAGTATCTTGCTTGGAGCCTGG - Intronic
1026974584 7:74489648-74489670 TCAGTTCCTTTCTAAGGGCAAGG + Intronic
1031454348 7:121960989-121961011 TCAGTACCTTTCTTAGAGCCTGG - Intronic
1032539245 7:132689699-132689721 TCAGAACTTCTGTTAGAGCCAGG + Intronic
1032817940 7:135496262-135496284 TCAGTATTTTTATTAGAGACGGG + Intronic
1037779686 8:21859287-21859309 TCTGTACCTTTCTTGGGGTCGGG - Intergenic
1038014506 8:23502630-23502652 TCAGTACCTTGCACAGTGCCAGG - Intergenic
1038678503 8:29645059-29645081 TCAGTACTTCTTATAGAGCCAGG - Intergenic
1038845661 8:31227144-31227166 TCAATTACTTTCTTAGAGGCTGG + Intergenic
1040489585 8:47907211-47907233 TCTGTACCTTTAGTAGAGACAGG + Intronic
1041547231 8:59059272-59059294 TTAATTCCTTTCTAAGAGCCTGG + Intronic
1042620789 8:70701451-70701473 TCTGTTTCTCTCTTAGAGCCAGG + Intronic
1043083894 8:75802670-75802692 TATGTAACTCTCTTAGAGCCAGG - Intergenic
1043185575 8:77144341-77144363 TCATTACCTTTCTTAAACACTGG - Intergenic
1046021645 8:108672460-108672482 TCAGTATCTTTCTTATTGTCTGG + Intronic
1046618543 8:116503063-116503085 ACAGTTCCTTGCTTAGTGCCTGG + Intergenic
1050194468 9:3066348-3066370 TCAGTGCCTTTTTCAGACCCAGG - Intergenic
1051522830 9:18009454-18009476 TGAGTACCTTGCATAGTGCCTGG + Intergenic
1051552559 9:18346326-18346348 TCAGTGCCTTTCTCAGAGCAGGG + Intergenic
1052558346 9:30049718-30049740 TCTGTACATTTTTTAAAGCCTGG + Intergenic
1053430411 9:38038517-38038539 TCAGTACCTTACTGTGTGCCAGG - Intronic
1055156952 9:73075116-73075138 TCAATATTTTTCTTAGAGCAAGG + Intronic
1056424937 9:86466645-86466667 GCATTACCTATCTCAGAGCCAGG + Intergenic
1058561286 9:106231907-106231929 ACAGAACCTATCATAGAGCCAGG - Intergenic
1059505489 9:114795905-114795927 TCAGTGATTTTGTTAGAGCCGGG + Intronic
1061807008 9:133142281-133142303 CCAGGACCTTCATTAGAGCCTGG - Intronic
1185492974 X:533231-533253 TCAGTATTTTTAGTAGAGCCGGG + Intergenic
1191909477 X:66132919-66132941 TCACTACCTTTCTTAGCCTCTGG + Intergenic
1198509409 X:137334554-137334576 ACAATACCTTTCATAGAGCGAGG - Intergenic