ID: 1031454372

View in Genome Browser
Species Human (GRCh38)
Location 7:121961245-121961267
Sequence CAGATTATGATCCATGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031454372_1031454379 27 Left 1031454372 7:121961245-121961267 CCAGGCACATGGATCATAATCTG 0: 1
1: 0
2: 0
3: 10
4: 96
Right 1031454379 7:121961295-121961317 CCTGCATTCACTCTGCTCATTGG 0: 1
1: 0
2: 1
3: 13
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031454372 Original CRISPR CAGATTATGATCCATGTGCC TGG (reversed) Intronic
901366984 1:8760880-8760902 CTTCTTATGTTCCATGTGCCAGG + Intronic
907379762 1:54076739-54076761 CAGATATTCATTCATGTGCCAGG + Intronic
911778651 1:101847004-101847026 CTGATTAAGATCCCGGTGCCGGG + Intronic
915194273 1:154177607-154177629 CAGATGCTTATCCAAGTGCCTGG + Intronic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
919781588 1:201224766-201224788 CAGCTTCTGATCCCTGTGGCTGG + Exonic
920640396 1:207746538-207746560 CAGGTTAGGAACCATGTGCAGGG - Intergenic
924926404 1:248687892-248687914 CAAATTTTTAGCCATGTGCCAGG + Intergenic
1065507091 10:26439455-26439477 CAAATTATGAAACTTGTGCCTGG - Intronic
1069764047 10:70838694-70838716 CAGATTATGATCCATTTAGAGGG + Intronic
1072229103 10:93398472-93398494 CAGATTCTGTCCCATGTGCTGGG - Intronic
1073994811 10:109302997-109303019 CAGAATATGATGCATGTCCCAGG - Intergenic
1076750162 10:132538286-132538308 CAGACTCTGATCCCTGTACCCGG + Intronic
1079869045 11:25772744-25772766 CAGAGTACTAGCCATGTGCCAGG + Intergenic
1080917136 11:36671611-36671633 CAGATTAGGAACCCTGTGCGGGG - Intergenic
1085229322 11:74951024-74951046 CTGATGATGATCCAAGTGCAAGG - Intronic
1088919114 11:114248831-114248853 CAGTTAATGATCCACCTGCCAGG - Intronic
1091677907 12:2504677-2504699 CAGATTCTGACCCATTGGCCAGG + Intronic
1094114315 12:26893814-26893836 CATTTAATGAACCATGTGCCAGG - Intergenic
1094437944 12:30441992-30442014 CAGGTCATTATCCATGTTCCTGG - Intergenic
1099151053 12:79114357-79114379 CAGATTATCCTACATGTACCAGG - Intronic
1100297271 12:93274643-93274665 CAGAGTGTGCCCCATGTGCCAGG + Intergenic
1111498226 13:89082510-89082532 TAGATTATAAGCCATCTGCCTGG + Intergenic
1114523703 14:23354674-23354696 CAGATTATGATTCAAGGGTCTGG - Intergenic
1117554829 14:56873133-56873155 GAGATTAAGACCCATGTTCCAGG - Intergenic
1119185131 14:72635258-72635280 CAGATGATAATCCATGAGGCTGG + Intronic
1122042010 14:98994816-98994838 AAGCTTCTGATCCATTTGCCTGG - Intergenic
1124722093 15:32119223-32119245 CAGATTCAGATCAGTGTGCCTGG + Intronic
1130200966 15:81826472-81826494 CAGTGTATGAGCCAGGTGCCAGG - Intergenic
1130607840 15:85333731-85333753 CAGTGTCTCATCCATGTGCCAGG + Intergenic
1134308326 16:13053545-13053567 CAGATTTTAATCCATGTGGATGG - Intronic
1134339188 16:13329433-13329455 CAGATTAAAATCCATGTGCTAGG + Intergenic
1135614128 16:23895794-23895816 CAGTGTGTGTTCCATGTGCCTGG - Intronic
1141362407 16:83408135-83408157 AAGATCATCATCCATGTGTCAGG - Intronic
1164128703 19:22342193-22342215 CAGATTGTGATTCATGTACTTGG + Intergenic
1165154753 19:33780271-33780293 CAGTTTATGATGGATGTGCAGGG + Intergenic
1165231615 19:34390800-34390822 CAGATTCTCATACCTGTGCCAGG - Intronic
1165309489 19:35021823-35021845 CAGATCCTGACCCCTGTGCCCGG + Exonic
1167782856 19:51611716-51611738 CACATCATGAACCAAGTGCCAGG + Intergenic
926382544 2:12304696-12304718 CAGGTTATGATCCATAAGCTTGG + Intergenic
927695123 2:25234618-25234640 CAGATCACCAACCATGTGCCAGG + Intronic
927902255 2:26828961-26828983 GAGAGGATGAGCCATGTGCCTGG - Intergenic
929143149 2:38684097-38684119 CAGGTTTTGAGCTATGTGCCTGG - Intronic
931547549 2:63406388-63406410 TTGAATATGAGCCATGTGCCAGG + Intronic
942616467 2:177796304-177796326 CAGATTATATTCCAGGTACCTGG + Intronic
942731823 2:179068636-179068658 CAGACCATCATCTATGTGCCAGG - Intergenic
942895298 2:181046088-181046110 CTGATTATCTACCATGTGCCAGG - Intronic
946738042 2:222774103-222774125 AAGACCATGAACCATGTGCCAGG - Intergenic
1173601122 20:44296212-44296234 CTGATCATGCTCCATCTGCCAGG - Intergenic
1175062885 20:56259734-56259756 CAGATTCTGATCCACAGGCCTGG + Intergenic
1175370316 20:58483860-58483882 CCCATTATCATCCATGTTCCAGG - Intronic
1178631682 21:34266573-34266595 AAGATTATGTTCCATGTTTCAGG - Intergenic
1182272526 22:29164320-29164342 CAGATTGAGATCATTGTGCCAGG - Intronic
1183795075 22:40110709-40110731 CAGATTAACATTCTTGTGCCAGG + Intronic
1184179432 22:42810067-42810089 AAGATTCTGATCCATGGGTCAGG - Intronic
952721068 3:36533242-36533264 CTGATGATGATGCCTGTGCCTGG - Intronic
953700561 3:45192303-45192325 CAGACTATGGACTATGTGCCAGG - Intergenic
956058992 3:65330922-65330944 CAGATTTTGATTCAAGAGCCAGG + Intergenic
957212723 3:77280993-77281015 CATATTCTGTTCCTTGTGCCTGG - Intronic
963324677 3:143849499-143849521 CAGATCATCTTCCATGTGGCAGG + Intergenic
967094742 3:186168083-186168105 CACATGATCATCCCTGTGCCTGG - Intronic
968286464 3:197511926-197511948 CAGATCATGACCCACTTGCCTGG - Exonic
969148955 4:5151973-5151995 CTGAATATGGTCCATGTGGCTGG - Intronic
969993877 4:11291947-11291969 CCTATTAGGATCCCTGTGCCAGG - Intergenic
973645582 4:52948257-52948279 CTGATTAAGAGCCATGTGCCAGG - Intronic
974157372 4:58091861-58091883 CAGAATATGATGCATGTAACAGG + Intergenic
974226423 4:59050932-59050954 CAGTTGATGTTCCATCTGCCTGG + Intergenic
980142334 4:128934384-128934406 CAGATATTGCTCCATGTGCTAGG + Intronic
981977675 4:150750295-150750317 TTGATTATAATCCATGTGCCAGG - Intronic
984976009 4:185230692-185230714 AAGATTATGATCCCTGGGCCAGG - Intronic
988521584 5:31950212-31950234 CAGATTCTGATCCACGAGCCTGG + Intronic
998082827 5:139291180-139291202 CACATTCTGATCCCTCTGCCTGG + Intronic
999115168 5:149156404-149156426 CTGAGTATTTTCCATGTGCCAGG - Intronic
1004166751 6:13263907-13263929 CATTTTATGATCGATGTACCTGG - Intronic
1008539174 6:52531654-52531676 CACATGCTGGTCCATGTGCCCGG + Intronic
1011863034 6:91784794-91784816 CAGATTCAAATCCATGTGCAAGG + Intergenic
1012132671 6:95517115-95517137 CAGATACTGATCCATGGCCCAGG - Intergenic
1012223019 6:96673987-96674009 AAGTTTATGATCAAGGTGCCAGG + Intergenic
1012622595 6:101364560-101364582 TAGATTATGTTCCATGTGAGAGG + Intergenic
1015548942 6:134392178-134392200 CAGATCATGATCCTACTGCCTGG - Intergenic
1016774964 6:147895468-147895490 CAGATGATGACACATTTGCCAGG + Intergenic
1018929187 6:168229116-168229138 CTGACTTTGATCCAGGTGCCCGG - Intergenic
1023033746 7:36112532-36112554 CATCTTAGGTTCCATGTGCCAGG + Intergenic
1023855708 7:44182393-44182415 CACATTTTGCTCCTTGTGCCAGG - Intronic
1026556192 7:71410739-71410761 CAATTTATGCTCCATGAGCCTGG + Intronic
1030752792 7:113251235-113251257 CTGAGAATGATCCATGTGCAAGG - Intergenic
1031454372 7:121961245-121961267 CAGATTATGATCCATGTGCCTGG - Intronic
1031485604 7:122319687-122319709 CAAATTATAATTTATGTGCCAGG - Intronic
1033603427 7:142907155-142907177 CAGCTAATCATCCTTGTGCCTGG - Intergenic
1034136798 7:148778417-148778439 CAGATAATGGTCCAAGTGCATGG + Intronic
1036062351 8:5337677-5337699 CAGATGAAGTACCATGTGCCTGG + Intergenic
1040104777 8:43535418-43535440 CTGATTATGATCCATTGACCAGG - Intergenic
1041689008 8:60671268-60671290 CAAATTATGATCCATCTGGTGGG - Intergenic
1044843791 8:96360571-96360593 CAGGTTATGATCCAGGTGCATGG + Intergenic
1045583991 8:103510333-103510355 CAGATTTTCATCTATGTGCCTGG - Intronic
1048128231 8:131661684-131661706 CAGATGATGATACAAATGCCAGG + Intergenic
1051264387 9:15297050-15297072 CAGATTCTGATCAATCTGGCTGG + Intronic
1055064679 9:72107075-72107097 CGGATTATGATCAAGGTGCCAGG + Intergenic
1055297672 9:74850931-74850953 CAAATAATGATTCATCTGCCTGG + Intronic
1058644788 9:107120741-107120763 CAGAGTATGAGCGATGTGCCAGG - Intergenic
1060633280 9:125179288-125179310 GAGATGATGATCCATGTACTGGG - Intronic
1060897472 9:127226484-127226506 CAGATGATGTCCCATGGGCCAGG - Intronic
1185478062 X:427111-427133 AAGGTTATGCTCCCTGTGCCGGG + Intergenic
1187916140 X:24153796-24153818 GAGATAATGGTCCATATGCCAGG - Intronic
1189439708 X:41024373-41024395 AAGATCATAATCCAGGTGCCAGG + Intergenic
1191167587 X:57406577-57406599 AAGGTTATGATCCCTGTGTCAGG - Intronic
1196177120 X:112651337-112651359 CTGACTATGACCTATGTGCCAGG - Intronic