ID: 1031454826

View in Genome Browser
Species Human (GRCh38)
Location 7:121966032-121966054
Sequence GATAAGAAGAGGTCTGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031454826 Original CRISPR GATAAGAAGAGGTCTGATTA GGG Intronic
901571581 1:10165338-10165360 GCTGAGAAGAGGTCAGATAATGG - Intronic
906447905 1:45919208-45919230 GATAAGAAGTGGTCAGATTTGGG + Intronic
906464713 1:46066899-46066921 GATACCAACAGGTATGATTATGG - Exonic
906489008 1:46253211-46253233 GATATGAACAGGTTTGTTTATGG + Intronic
907171266 1:52467490-52467512 GATGAGAAGTGGTCAGATTTGGG - Intronic
907516181 1:54994825-54994847 CACAAGATGAGGTCTGAATAGGG - Intergenic
907612634 1:55888065-55888087 GATGAGCACAGGTCTCATTAGGG - Intergenic
907911785 1:58833608-58833630 GGTAAGTAGGGGTCTGAGTACGG + Intergenic
907981813 1:59489916-59489938 GATAAGATGATATCTCATTATGG + Intronic
908102228 1:60803363-60803385 GATAAGATGATATCTCATTATGG + Intergenic
909624737 1:77703114-77703136 AAGAAGATGAGGTCAGATTATGG - Intronic
909679037 1:78270653-78270675 GGTGAGAAGAGATGTGATTATGG - Intergenic
910005802 1:82395745-82395767 AATCAGCAGAGCTCTGATTAAGG - Intergenic
910317856 1:85908038-85908060 GATAAGAAAAGTTCTGCTCAGGG + Intronic
910761137 1:90732479-90732501 GCTAAGAAGAGGCCAAATTATGG - Intergenic
911291917 1:96066660-96066682 GATAAGATGATATCTCATTATGG + Intergenic
915660959 1:157404476-157404498 GATAGGAAAAGGTCTGGTTGAGG - Intergenic
917514897 1:175699083-175699105 GATAAGAAGTGGTTTGATTTTGG + Intronic
917669913 1:177263670-177263692 GAAGAGAAGAGGTGAGATTAGGG + Intronic
919181784 1:194094003-194094025 GAAAATAAGAGGTGTGATGAGGG + Intergenic
920124425 1:203682325-203682347 GATGAGAAGAGGTCAGAAAAAGG - Intronic
920919666 1:210288074-210288096 GATAAGAAGTAGTCTGATTTGGG + Intergenic
923402220 1:233626158-233626180 GATGAGAAGTGGTCAGATTCTGG + Intronic
923638271 1:235723385-235723407 GAAGAGAAGAGGTCTGAGGAAGG + Intronic
924671467 1:246130939-246130961 GTTAAGACGAGGTTTGATTGTGG - Intronic
1066254968 10:33669974-33669996 GAAAAGCAGAGTTCTGCTTAGGG + Intergenic
1068706518 10:60082245-60082267 GATATGAAAAGGACTGAGTAGGG + Intronic
1069171811 10:65240480-65240502 GATAAAAAGAGCTCTGGTGATGG + Intergenic
1069967542 10:72133666-72133688 TATAAGCAGTGGTCAGATTAGGG + Intronic
1072979509 10:100088053-100088075 GATAAGTAGAGTTCTGGTTTGGG - Intergenic
1073723201 10:106198631-106198653 GATAACAAGGGGACTGATCAAGG + Intergenic
1074154425 10:110786127-110786149 GAGAAGAAGAGGTCAGATGGGGG - Intronic
1074836140 10:117296722-117296744 GACAAGTAGATGTCTGAATAGGG + Intronic
1075891822 10:125958172-125958194 GATAGGAAGAGGTTTGCTAAAGG - Intronic
1076275545 10:129195705-129195727 CATAAGAAGGGGTCAGATTCTGG - Intergenic
1077826820 11:5819855-5819877 GATAAGAACTGGTCATATTAGGG + Intronic
1079287707 11:19153934-19153956 GGTAAGAAGGGGTCAGATTCTGG - Intronic
1079407049 11:20156603-20156625 GAGAAGCAGAGGTCAGATCAGGG + Intronic
1079674552 11:23209406-23209428 GATAAGAAGAGGTGGAAATATGG - Intergenic
1080698003 11:34619865-34619887 GAAAAAAAAAGGTCTGCTTATGG - Intergenic
1081016119 11:37883085-37883107 GATAAGAACAGGACTGAGAAAGG + Intergenic
1081016341 11:37886145-37886167 GATAAGAACAGGACTGAGAAAGG + Intergenic
1083741839 11:64715427-64715449 GATAAGGAGAGGGCTGACTTCGG + Intronic
1083790387 11:64980978-64981000 GAAAAGAAGTGGTCGGATTCAGG - Intergenic
1086609127 11:88732696-88732718 GATAAAGAGACTTCTGATTAAGG + Intronic
1087376427 11:97347870-97347892 GATAAGAAGAGATTTGTTAAAGG + Intergenic
1091002560 11:131922597-131922619 GGTAAAAAGTGGTCTGATTCAGG - Intronic
1092278063 12:7077249-7077271 GGTGAGAAGTGGTCAGATTATGG - Intergenic
1094391273 12:29953102-29953124 AATATGATCAGGTCTGATTAAGG - Intergenic
1094626906 12:32132925-32132947 GGTAAGAAGTGATCTGATTCAGG + Intronic
1096360996 12:50986703-50986725 GATATGAAGAGGAATGGTTAGGG + Exonic
1097627689 12:62021114-62021136 GAAAACAAGAGGTCTAATTATGG + Intronic
1097903445 12:64896375-64896397 GGTAAGAAGTGGTCAGATTCTGG + Intergenic
1098614502 12:72506800-72506822 GATGAGAAGAGGTTAGATTCTGG - Intronic
1099215160 12:79844491-79844513 GATGAGAAGAGATTGGATTATGG - Intronic
1100104598 12:91154557-91154579 GCTAAGAAGAAGTTTGACTATGG + Intronic
1100893787 12:99156669-99156691 GATTAGAAGAGGTTTCATAATGG - Intronic
1101139674 12:101782496-101782518 GATAAGAAGTGGTTGGATTCTGG - Intronic
1104223645 12:126810503-126810525 GGTGAGAAGAGCTCTGATTCTGG + Intergenic
1105379847 13:19876741-19876763 GATAAGAAAAGTTCTGAAAATGG - Intergenic
1106237817 13:27879661-27879683 AAGATGAAGAGGTCTGAATATGG + Intergenic
1107619392 13:42210632-42210654 GATAAGCAGAAGTGTGATTCTGG + Exonic
1107982109 13:45743837-45743859 GATATGGAAGGGTCTGATTATGG - Intergenic
1108219524 13:48218770-48218792 GTTAATAAGAGGTCTGAACAGGG + Intergenic
1109996645 13:70135649-70135671 GATAAGAAGTGCTGTTATTAAGG - Intergenic
1113256227 13:108509171-108509193 TATAAGTAGAGGACTGATCAAGG + Intergenic
1114222029 14:20705201-20705223 TTTAAGAAGAGGTTTTATTAAGG - Intergenic
1114553772 14:23549935-23549957 GGTAGGAAGAGGGCAGATTATGG + Intronic
1114920033 14:27314505-27314527 AAAAAGAAGAGGTCAGCTTATGG - Intergenic
1115728508 14:36242901-36242923 GAAGAGAAGAGGACTGATGAAGG + Intergenic
1118470724 14:66072965-66072987 CATAAGAAGAGGTGTTATTTGGG + Intergenic
1202829064 14_GL000009v2_random:6060-6082 GCTGAGAAGAGGTCTGTTTAGGG + Intergenic
1202900781 14_GL000194v1_random:35913-35935 GCTGAGAAGAGATCTGTTTAGGG + Intergenic
1202928399 14_KI270725v1_random:15291-15313 GATAAGAAGGGGTAGGATTATGG + Intergenic
1125105586 15:35967366-35967388 GATCAGCAGAGGACTGACTAGGG - Intergenic
1125223196 15:37364642-37364664 GAAAAGAAGAGGTTACATTATGG + Intergenic
1125553958 15:40569126-40569148 AATAGGAAGACGTCTGAGTAAGG + Intergenic
1126056325 15:44733271-44733293 GATAAGAAGACCACTGACTATGG + Intronic
1126737779 15:51749712-51749734 AATAAGAACAGGGCTGCTTACGG - Intronic
1127307499 15:57722429-57722451 GAAAAGAAGAGGTGTGAAAATGG - Intronic
1128058790 15:64720242-64720264 GATAATAAGAGTTGTGATTTGGG - Intergenic
1128105716 15:65043250-65043272 GATGAGAAGTGGTCAGATTCAGG - Intergenic
1128194920 15:65744124-65744146 GATGAAAAGAGGTCAGATTCTGG + Intronic
1133712504 16:8414980-8415002 GATGAACAGATGTCTGATTAAGG - Intergenic
1134439440 16:14289413-14289435 GATAAGAAGGGCTCTGATGCTGG + Intergenic
1135290423 16:21232645-21232667 GATATGAAGTGGTCTTATTATGG - Intergenic
1136037429 16:27550450-27550472 GAGAAGTAGAGGTCTGAGGAGGG + Intronic
1137352698 16:47727431-47727453 CAGAAGAAGAGCTCTGCTTATGG - Intergenic
1137427544 16:48392239-48392261 GATAACAAGAGGTCTGAGCCAGG + Intronic
1140058782 16:71549240-71549262 GGTGAGAAGTGGTCTGATTCAGG - Intronic
1143332094 17:6144985-6145007 GATAAGATCAGGTCTGTTTTAGG - Intergenic
1143640350 17:8192833-8192855 GATGAGAAGTGGTCAGATTCTGG - Intergenic
1144763219 17:17719043-17719065 GATGAGAAGGGGTCGGATTTTGG - Intronic
1147807300 17:43140893-43140915 AATAAGGCGATGTCTGATTAGGG - Intergenic
1148002989 17:44401052-44401074 GATGAGAAGAGTTCTGACCAAGG - Exonic
1149415311 17:56453595-56453617 GATAAGAAGAGTCCTCAATATGG - Intronic
1150865257 17:68842472-68842494 TGTGAGAAGAGGTATGATTATGG + Intergenic
1151503068 17:74504832-74504854 TTTAAGAAGAGGTTTTATTAAGG - Intergenic
1154065882 18:11106595-11106617 GTAAAGAAGAGGTCTCATTATGG + Intronic
1155281702 18:24246874-24246896 GATGAGAAGTGGTCAGATTCTGG + Intronic
1158150660 18:54365519-54365541 GATAAGAAGGGGTTGGATTCTGG + Intronic
1163871269 19:19823261-19823283 GACAAGGAGAGGTCTCATGAAGG - Intergenic
1202643634 1_KI270706v1_random:121729-121751 GCTGAGAAGAGGTCTGTTTAGGG - Intergenic
928586237 2:32761294-32761316 GGTAAGAAGCAGTCTGATTCTGG - Intronic
928985166 2:37173747-37173769 GATGAGAAGAGGTTGGATTCTGG - Intronic
929611273 2:43272510-43272532 GATGAGAAGTGGTCAGATCAAGG - Intronic
930259129 2:49124665-49124687 GATGAGAAGGGGTCGGATTCTGG - Intronic
930861442 2:56078348-56078370 GATAATAAGAGGACTGAGTATGG + Intergenic
932320820 2:70820813-70820835 GAGAAGAAGAGGTGTGTTTGGGG - Intergenic
932863502 2:75318117-75318139 GATAAGAAGTGGTCTTATCCTGG + Intergenic
933866683 2:86524924-86524946 GATAAACAGAGGTCTGAAAAAGG - Intronic
934506069 2:94895643-94895665 GCCGAGAAGAGGTCTGTTTAGGG - Intergenic
935222936 2:101030451-101030473 GGTAAGAAGTGGTATAATTATGG - Intronic
935938817 2:108217363-108217385 GATAAGAAGAGGTCATGTTCTGG - Intergenic
937377021 2:121344269-121344291 TGTACGAAGAGGTCTGATGAAGG - Intronic
939113255 2:138032452-138032474 GATCAGAAGAGGTCTCTTTCAGG + Intergenic
940933642 2:159466574-159466596 TATAATTAGAGGTCTAATTAAGG + Intronic
941438966 2:165509479-165509501 GATGAGAAGTGGTCAGATTGAGG + Intronic
942619132 2:177829028-177829050 GGTAAGAAGTGGTCAGATTCTGG + Intronic
944338819 2:198570195-198570217 GATACGAAGAGGTTTGTTAATGG + Intronic
945200111 2:207272660-207272682 GATAAGAGCAGGTCTGAGTAAGG + Intergenic
1168915633 20:1483445-1483467 GATAAGACGATATCTCATTATGG + Intronic
1170976884 20:21173242-21173264 GGTAAGAAGTGGTCAGATTCTGG + Intronic
1171893600 20:30740679-30740701 GCTGAGAAGAGGTCTGTTTAGGG - Intergenic
1175512766 20:59544629-59544651 GAAAACAAGAGCACTGATTAAGG - Intergenic
1175657053 20:60780039-60780061 GATCAGATAAGGTCAGATTAGGG + Intergenic
1175757735 20:61540081-61540103 AATATGAAGAGGGCTGAATAGGG + Intronic
1176590427 21:8643934-8643956 GATAAGAAGGGGTAGGATTATGG + Intergenic
1176608248 21:8850899-8850921 GCTGAGAAGAGGTCTGTTTAGGG + Intergenic
1176620155 21:9050691-9050713 GCTGAGAAGAGATCTGTTTAGGG + Intergenic
1176888926 21:14290625-14290647 GATAAGAAGTGGTCAGACTCTGG + Intergenic
1180273255 22:10620967-10620989 GATAAGAAGGGGTAGGATTATGG + Intergenic
1180358331 22:11860704-11860726 GCTGAGAAGAGGTCTGTTTAGGG + Intergenic
1180379931 22:12131626-12131648 GCTGAGAAGAGGTCTGTTTAGGG - Intergenic
1182155965 22:28073248-28073270 CATGAGAAAAGGTCTGATTTTGG + Intronic
949136855 3:577741-577763 GATAAGAAGGGGTAGGATTATGG - Intergenic
951941678 3:28086435-28086457 GGAAAGAAGAGGTTTGATCAAGG + Intergenic
953545068 3:43858294-43858316 GATAAGAAGAGGAAGGAGTATGG - Intergenic
953546753 3:43869213-43869235 GAGAAGAAGAGGTCTGCCTTAGG + Intergenic
955152618 3:56383088-56383110 GGTGAGAAGTGGTCAGATTATGG - Intronic
955536904 3:59933219-59933241 GAGAAGAAGAGGACTGAATTTGG - Intronic
957151863 3:76496799-76496821 GATGAGAAGTGGTCAGATTCTGG - Intronic
958075508 3:88671643-88671665 GATGAGACTATGTCTGATTAGGG - Intergenic
958193825 3:90217612-90217634 GGTAAGAAGTGGTCAGATTCTGG - Intergenic
958417181 3:93888661-93888683 GGTAAGAAGTGGTCAGATTCTGG - Intronic
960926907 3:122803403-122803425 GAAGAGATGAGGTCTCATTAGGG + Intronic
961455417 3:127021523-127021545 GACAGGAAGAGGTTTGATTAGGG - Intronic
961940060 3:130627693-130627715 AATAATAAGAGGACTGATTTTGG - Intronic
962169477 3:133085688-133085710 GATAATAAGATGTCCCATTAAGG + Intronic
964074242 3:152673968-152673990 GATAAGATGACATCTTATTAGGG - Intergenic
964251391 3:154722005-154722027 GACCGGAAGAGGTCAGATTAAGG + Intergenic
965144440 3:164882459-164882481 GATAAAAAATGGTATGATTATGG - Intergenic
966818965 3:183910188-183910210 AATAAGAAGAGGGCTGAACATGG + Intergenic
967499332 3:190178727-190178749 TATAAGAAGAGATCTTCTTATGG - Intergenic
970764293 4:19528883-19528905 GATAAGATGATATCTCATTATGG - Intergenic
970877653 4:20891059-20891081 GATAAGAATAGTTCTCATTATGG - Intronic
971248624 4:24952768-24952790 GATAAAAAGAGTTCCGATGACGG - Intronic
973018933 4:45175069-45175091 GATTAGAAGAGGTATTAATAAGG - Intergenic
974133611 4:57787477-57787499 GGTAAGAAGTGGTCAGATTTGGG + Intergenic
977118316 4:93062027-93062049 ATTTATAAGAGGTCTGATTAAGG + Intronic
977180210 4:93865000-93865022 GATAAGAAAAGATCTGTTAAAGG + Intergenic
978505049 4:109447720-109447742 GGTAAGCAGAGGTCAGATGATGG + Intronic
979049922 4:115917522-115917544 GATAAGAAGAGGCATGAACATGG + Intergenic
979382510 4:120024357-120024379 GATAAGAAGAGATTTGTTAAAGG + Intergenic
980844707 4:138310566-138310588 GATAAGAAGACAGCTGACTATGG - Intergenic
981831015 4:149001938-149001960 GGTAAGAAGTGGTCAGATTCTGG - Intergenic
983136214 4:164084167-164084189 GATAAGAGAAGCTGTGATTATGG + Intronic
984112957 4:175643089-175643111 GGGAAGAATCGGTCTGATTATGG - Intronic
1202771001 4_GL000008v2_random:207642-207664 GCTGAGAAGAGGTCTGTTTAGGG - Intergenic
985844574 5:2334770-2334792 GATCAGAAGAGGCCTGAAAACGG - Intergenic
990350175 5:54908336-54908358 AATAAGAAGAGAGCTGGTTAGGG + Intergenic
991515600 5:67431641-67431663 GATAGAAAGAGGCCAGATTAGGG - Intergenic
1001388375 5:171358639-171358661 GAAAAGAAGAGATTTGAATAAGG + Intergenic
1001747538 5:174103241-174103263 GGTAAAAAGTGGTCAGATTATGG + Intronic
1004441057 6:15654841-15654863 GAACAAAAGAAGTCTGATTATGG + Intronic
1006045842 6:31297527-31297549 GACAAGAAGATGACTGATGAAGG + Intronic
1006273618 6:32983425-32983447 GATAAGACAAGGTCTTATCATGG + Intergenic
1007883132 6:45189534-45189556 CATAAGATGGGGTCTGAATAAGG + Intronic
1008893873 6:56529069-56529091 GAAAAGAAGAGGTCTAAACATGG - Intronic
1009568967 6:65355768-65355790 TATAAGATGATGTCTCATTATGG - Intronic
1010488074 6:76439706-76439728 GATAAGAAGGGGTATGGTTGTGG - Intergenic
1011072375 6:83399968-83399990 GGTAAGATGAGGTCTGAGAATGG - Intronic
1011116769 6:83901737-83901759 GATAGGATGATGTCTAATTATGG + Intronic
1011175111 6:84551614-84551636 GATGAGAAGTGGTCAGATTCTGG - Intergenic
1011407419 6:87030727-87030749 GATAGGAAGAGGTGTGATACAGG - Intergenic
1011465074 6:87646991-87647013 GGCAAGAAGAGGTCTGATTCTGG - Intronic
1012312322 6:97740837-97740859 GACAAGATGAGGCCTTATTAAGG - Intergenic
1013644519 6:112123321-112123343 GATAAGAAAAGTTCTGGTTGAGG + Intronic
1016407841 6:143749028-143749050 GATAAGAAGGGGAGTGCTTAAGG + Exonic
1016649782 6:146450009-146450031 GATAAGATGTGGTCTACTTATGG - Intergenic
1019847622 7:3522012-3522034 AATAAGAAGATGCCTGATTGTGG - Intronic
1020591425 7:10143127-10143149 AATAAGAATAGTTCTGATTTTGG + Intergenic
1020626147 7:10581798-10581820 GGTGAGAAGTGGTCAGATTATGG + Intergenic
1020722733 7:11768706-11768728 GATAAGAAAAGATATCATTAAGG + Intronic
1024114211 7:46177079-46177101 GATAACAAAAGGTCTTATGAAGG - Intergenic
1024811371 7:53216812-53216834 GCTCAGCAGAGGTCTGATTTTGG - Intergenic
1028071366 7:86455043-86455065 GATGAGAAGAGGTAAAATTAAGG + Intergenic
1028470745 7:91204014-91204036 TTTAAGAAGAGGTTTGATAAAGG + Intronic
1028777213 7:94691667-94691689 GGTAAGATGAGGTCTTATTGTGG + Intergenic
1029067954 7:97871707-97871729 GCCGAGAAGAGGTCTGTTTAGGG - Exonic
1029978904 7:104859690-104859712 TATAAGTAGAGGTATGAATAGGG + Intronic
1030756897 7:113296919-113296941 GGTAAGATGATGTCTTATTATGG - Intergenic
1031454826 7:121966032-121966054 GATAAGAAGAGGTCTGATTAGGG + Intronic
1034516696 7:151586458-151586480 GCGGAGAAGAGGTCTGATTTCGG - Intronic
1037580398 8:20242318-20242340 GATAAGAAGGTGTCTGCTGAGGG + Intergenic
1037590269 8:20306008-20306030 GATAAGAGAAGGTGTGAGTAAGG - Intergenic
1042703334 8:71640660-71640682 GATAAAATGGGGTCTGGTTAAGG + Intergenic
1042819390 8:72913730-72913752 GATAAGACCAGGTCTGATCCTGG - Intronic
1044270386 8:90235805-90235827 GATAAGAAGAGATGAGATCATGG + Intergenic
1044323993 8:90839598-90839620 ACTAAGAAGAGGTATGAATAAGG + Intronic
1044885439 8:96772025-96772047 TATAAGTAGAGGTATGAGTAGGG + Intronic
1044933209 8:97269874-97269896 TATAAGAAGAAGTCTGGTAATGG - Intergenic
1046010583 8:108541970-108541992 AACAAGAAGAGCTCAGATTAAGG - Intergenic
1046553537 8:115747211-115747233 GATAAGAAGAGGTTTGTTAATGG + Intronic
1047167193 8:122452300-122452322 CATAAGAAGGGGTCTTATGATGG + Intergenic
1048670439 8:136713064-136713086 GATAAGAAGTTGTGTGATTTTGG - Intergenic
1048930105 8:139308183-139308205 AATTAGAAGAGCACTGATTATGG + Intergenic
1050693006 9:8249576-8249598 GATAAGAAAAGGTTGGATTCTGG - Intergenic
1050802737 9:9636530-9636552 TATAAGAAGAAATCTGATGAGGG + Intronic
1051378049 9:16424807-16424829 GATAAGAAAAGGACTAATGAAGG - Intronic
1052123245 9:24743898-24743920 GAAAACAAGAGGACAGATTATGG + Intergenic
1052383961 9:27803285-27803307 GAAAAGAAGAGGGCAGATTCAGG + Intergenic
1053387169 9:37702054-37702076 GAGAAGATAAGTTCTGATTAGGG + Intronic
1054355038 9:64052041-64052063 GCTGAGAAGAGGTCTGTTTAGGG + Intergenic
1055145696 9:72932046-72932068 GCTCAGAAGAGGTCTGAACAGGG - Intronic
1055466395 9:76570750-76570772 GCTAACAAGAGTTCTGAGTATGG - Intergenic
1055716237 9:79121128-79121150 GATAAGATAAGGTTTGATGAAGG + Intergenic
1056890753 9:90489452-90489474 GGTAAGAAGAGGTTAGATTTAGG - Intergenic
1060388706 9:123259135-123259157 GATGAGAAGTGGTCAGATTCTGG + Intronic
1060772817 9:126345157-126345179 GCTAGGAAGAGGTCTGAGCATGG - Intronic
1062007447 9:134247623-134247645 TATAAGAAAAAGTGTGATTATGG - Intergenic
1203743371 Un_GL000218v1:21146-21168 GCTGAGAAGAGGTCTGTTTAGGG + Intergenic
1203703647 Un_KI270742v1:16113-16135 GCTGAGAAGAGATCTGTTTAGGG + Intergenic
1203620433 Un_KI270749v1:122599-122621 GATAAGAAGGGGTAGGATTATGG + Intergenic
1187534425 X:20125891-20125913 GGTAAGAAGCGGTCTCTTTAGGG + Exonic
1187651056 X:21406723-21406745 GATCAGAAGAGGTAGGAGTAGGG + Intronic
1187711060 X:22054871-22054893 GGTAAGAAGTTGTCAGATTAGGG + Intronic
1187967593 X:24627781-24627803 GGTAAGAAGTGGTCAGATTCTGG + Intronic
1188088523 X:25933386-25933408 TTCAAGCAGAGGTCTGATTAGGG - Intergenic
1194461530 X:94175586-94175608 GGTAAGAAGTGGTCAGATTCTGG + Intergenic
1196486969 X:116223181-116223203 GGTTAAAAGAGGTCAGATTAGGG + Intergenic
1198812846 X:140553271-140553293 CATAAGAAAAGGTTGGATTAAGG + Intergenic
1200366276 X:155668369-155668391 GATAAGAAAAAGTCTGAATAGGG + Intronic
1201156896 Y:11138617-11138639 GCTGAGAAGAGGTCTGTTTAGGG + Intergenic