ID: 1031455386

View in Genome Browser
Species Human (GRCh38)
Location 7:121972886-121972908
Sequence CAACCCAAAGTGCCACAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031455385_1031455386 -5 Left 1031455385 7:121972868-121972890 CCACTTGCTGGTAAGTAGCAACC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1031455386 7:121972886-121972908 CAACCCAAAGTGCCACAAAATGG 0: 1
1: 0
2: 1
3: 23
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031455386 Original CRISPR CAACCCAAAGTGCCACAAAA TGG Intronic
900731357 1:4263364-4263386 AATCTCAAAGTGCAACAAAAGGG - Intergenic
901819475 1:11817925-11817947 CAACCCAAGTTTCCCCAAAATGG - Intronic
907438576 1:54464683-54464705 AAGGCCAAAGTGCCACAAAGAGG - Intergenic
909238019 1:73177951-73177973 CAATCTTAAGTGCCACAAATGGG + Intergenic
910552368 1:88490143-88490165 CATAACAAAGTGCCACAAACTGG - Intergenic
910735787 1:90455502-90455524 CCACCCAAAGTCCAACAATATGG + Intergenic
911651751 1:100396800-100396822 AAACCAAAAGTGCCACAAGATGG - Intronic
912145135 1:106784439-106784461 CAACCCACAGTGACACAGCAGGG + Intergenic
912676391 1:111685255-111685277 AAAGCCAAAATGCCACAAATGGG + Intronic
914457624 1:147850882-147850904 CAAATCAAAGTACCACAAACTGG - Intergenic
914973139 1:152329783-152329805 CAATCCATATTGCCATAAAATGG - Intergenic
917782863 1:178417772-178417794 AAAAAAAAAGTGCCACAAAAAGG + Intronic
917789834 1:178492458-178492480 CAAGCCAAATTCCCAGAAAAGGG + Intergenic
918944604 1:191047068-191047090 TAAAGCAAAATGCCACAAAAAGG + Intergenic
919132677 1:193470977-193470999 GAATCTAAAGTGCCCCAAAATGG + Intergenic
920847156 1:209603676-209603698 GAAGCCACAGTGCCAGAAAAGGG - Intronic
923314287 1:232764827-232764849 CTACCCAAGGTGCTATAAAAAGG - Intergenic
923341798 1:233013953-233013975 CAGCCCATAGTGCTAAAAAAGGG + Intronic
1062767842 10:79388-79410 CGTAACAAAGTGCCACAAAATGG - Intergenic
1064308837 10:14193381-14193403 CAAACCAAACTTCCAGAAAACGG + Intronic
1067514113 10:46922015-46922037 CATAACAAAGTGCCACAAATTGG - Intronic
1067648140 10:48129817-48129839 CATAACAAAGTGCCACAAATTGG + Intergenic
1067988987 10:51188110-51188132 CATCGTATAGTGCCACAAAATGG - Intronic
1068128223 10:52867156-52867178 CATCACAAAGTTCCACAAATGGG + Intergenic
1070953495 10:80449355-80449377 GAAACCAGAGTGACACAAAACGG - Intergenic
1071178795 10:82958974-82958996 CAGCTGAAAGTGCCACAAAATGG + Exonic
1071929894 10:90456937-90456959 CATAGCAAAGTGCCACAAACTGG - Intergenic
1072338706 10:94424647-94424669 CAACAGAAAGAGACACAAAATGG + Intronic
1073006567 10:100329741-100329763 CACCCCAAAGTGACACCGAAAGG + Intronic
1073206477 10:101772066-101772088 GAACCCAAAGTGGCAGAAACAGG - Intronic
1075622929 10:123940846-123940868 CGTCCAAAAGTGCCACAAACAGG + Intergenic
1077746867 11:4916195-4916217 CAACCCACAGTGCCAGCAGAGGG - Intronic
1080534130 11:33205294-33205316 CAACCCCAAATGTCACAAGATGG + Intergenic
1081303320 11:41479991-41480013 CATCACAAATTGCCACAAACTGG - Intergenic
1081635403 11:44718245-44718267 CATGTCAAAGTGCCACAAACTGG + Intergenic
1081890273 11:46535721-46535743 CAAGCCAAAGACCAACAAAATGG + Intronic
1082883180 11:58058334-58058356 CCATCCAAAGTGCCAGAGAAGGG - Intronic
1083111789 11:60417203-60417225 CAATCCAGAGTTACACAAAAAGG + Exonic
1085544319 11:77302809-77302831 CCACTCAAAGGGCCACAAATGGG + Intergenic
1087132888 11:94684123-94684145 CATAACAAAGTGCCACAAACTGG + Intergenic
1088568057 11:111194473-111194495 CAACCCACAGCCCAACAAAAAGG + Intergenic
1090639203 11:128716256-128716278 CAAGCCAAAATGTCAGAAAAGGG + Intronic
1093549807 12:20394440-20394462 TTGCCCAAAGTGCCACAAAGAGG - Intronic
1094159059 12:27370556-27370578 AAACCAACAGTGCCACAGAAAGG - Intronic
1095785047 12:46100950-46100972 CAAGGCAAAGTCCCACAATAGGG + Intergenic
1096336730 12:50762648-50762670 CGACCCAAAGGGCCAAAAATAGG + Intergenic
1098075643 12:66727614-66727636 CAAACCTAACTGACACAAAAGGG + Intronic
1099218688 12:79885482-79885504 CCACCAAAAGTGGCACTAAAAGG - Intronic
1099440850 12:82697867-82697889 CAAACCAAATTTCCTCAAAATGG - Intronic
1101530824 12:105571805-105571827 CAAAACCAAGTGCCAAAAAAAGG - Intergenic
1101833212 12:108275340-108275362 CAAATCAAAGTGCCACAAACCGG + Intergenic
1103582740 12:121927626-121927648 CAACCTAAATGGCCACAGAAAGG - Intronic
1103619351 12:122176982-122177004 CTTCCCAAACTGCCACAATATGG + Intronic
1105204184 13:18206342-18206364 GAACCCAAAGTTTCACAAAAGGG - Intergenic
1106650632 13:31686435-31686457 CATCACAAAGTACCACAAACTGG + Intergenic
1109041290 13:57340735-57340757 CAACTCAAAATGACTCAAAATGG + Intergenic
1109829486 13:67768918-67768940 AATACCAAAGTGCCACTAAAAGG + Intergenic
1109848087 13:68023933-68023955 CAAACCAAAGTGCAACTCAATGG - Intergenic
1110343921 13:74424300-74424322 CATAACAAAGTACCACAAAATGG + Intergenic
1110550348 13:76805048-76805070 CACAACAAAGTGCCACAAACTGG + Intergenic
1110672512 13:78198249-78198271 TAACTTTAAGTGCCACAAAATGG + Intergenic
1111316494 13:86567856-86567878 CTATCCAAAGTGAAACAAAAGGG - Intergenic
1112715668 13:102182025-102182047 CATAACAAAGTACCACAAAATGG - Intronic
1113378009 13:109782531-109782553 CAACCCCAAGCGCCACAACTCGG - Exonic
1114346504 14:21801360-21801382 CAATCCAATGTGCATCAAAAGGG - Intergenic
1115286335 14:31717074-31717096 AAAAACAAGGTGCCACAAAAGGG - Intronic
1115997436 14:39209336-39209358 GATCCCAAAGTTCCACAACAAGG - Intergenic
1116403968 14:44545384-44545406 CTACCTGAAGGGCCACAAAAAGG + Intergenic
1116977286 14:51130472-51130494 CATCTCCAAGTGCCAGAAAATGG - Intergenic
1117061056 14:51964403-51964425 CAACCCTAATTGACACAAAGAGG - Intronic
1118074623 14:62284432-62284454 CAACCCAAAAAGTCACCAAAAGG - Intergenic
1118895526 14:69942602-69942624 CAAACCAAAGTGACAGAAATTGG - Intronic
1120228963 14:81822261-81822283 CAATACTAAGAGCCACAAAATGG - Intergenic
1121255383 14:92526797-92526819 CATAACAAAGTGCCACAAACTGG + Intronic
1121279983 14:92691182-92691204 CATAGCAAAGTGCCACAGAATGG + Intergenic
1124514366 15:30354149-30354171 TAAAACAAAGTGCCTCAAAAAGG + Intergenic
1124728554 15:32176616-32176638 TAAAACAAAGTGCCTCAAAAAGG - Intergenic
1126667487 15:51088653-51088675 CAACCGAAACTGCCCCAAAGAGG + Intronic
1127564797 15:60176710-60176732 CATGACAAAGTGCCACAAATTGG + Intergenic
1127867802 15:63045919-63045941 CAACCTAAAGTGTCCTAAAAGGG - Intronic
1128411213 15:67400227-67400249 CTACCTAAAGTGCTACAAATGGG + Exonic
1128628393 15:69236170-69236192 CAACCCAAATGTCCACCAAATGG - Intronic
1130007404 15:80113025-80113047 CAACACAAAGTGTTACACAAAGG - Intronic
1131981576 15:97999674-97999696 CATCACAAAGTACCACAGAATGG - Intergenic
1132215636 15:100059726-100059748 CAACCCAAGCTGCCACAGAAGGG - Intronic
1132456776 16:28481-28503 CGTAACAAAGTGCCACAAAATGG - Intergenic
1133797940 16:9061740-9061762 CAACCCAAAGTGCCACAGCTGGG + Intergenic
1138425712 16:56931055-56931077 CATAACAAAGTGCCACAAACTGG - Intergenic
1139683060 16:68580516-68580538 GAACCTGAAGAGCCACAAAAGGG + Intergenic
1140731193 16:77858194-77858216 CAAGTCAAAGGGGCACAAAAGGG + Intronic
1140766693 16:78166283-78166305 CAACCTAAATGGCCACCAAAGGG - Intronic
1143962407 17:10731521-10731543 TAACCCCCAGTGCCTCAAAATGG + Intergenic
1145113722 17:20188724-20188746 AAAACCAAAGTGCTACACAAAGG + Intronic
1145736125 17:27233075-27233097 CAGCCCAAAGGGCAACTAAAGGG - Intergenic
1146158677 17:30547057-30547079 TAACCCCAAGTGCCTCAGAATGG + Intergenic
1146552801 17:33796251-33796273 CACACCAGAGTGCCACAGAATGG + Intronic
1148037367 17:44677094-44677116 CAACCCAAAATCCCAAAATAAGG + Intronic
1151946778 17:77323900-77323922 CATCACCAAGTGCCACAAACTGG + Intronic
1152960667 18:78720-78742 CGTAACAAAGTGCCACAAAATGG - Intergenic
1153328506 18:3847799-3847821 CTACACAAAGTGCCCCAAAAGGG + Intronic
1153922868 18:9806599-9806621 CCACCCAAGATGCCACAGAATGG + Intronic
1156455800 18:37293177-37293199 CATACCAAAATGCCACAAACTGG + Intronic
1156791783 18:40984231-40984253 CAACCCAAAGGGACACACAAGGG - Intergenic
1156792850 18:40998608-40998630 CAACCAAAAAACCCACAAAATGG + Intergenic
1157174876 18:45442264-45442286 CATCACAAAGTGCCGCAAACTGG + Intronic
1157622619 18:49025115-49025137 CACGACAAAGTGCCACAAACAGG - Intergenic
1158639301 18:59189574-59189596 CAACCAAATGTACCGCAAAATGG + Intergenic
1159456805 18:68669541-68669563 CATAACAAAGTGCCACAAACTGG + Intergenic
1164899677 19:31907861-31907883 CAACCCAGTAAGCCACAAAAAGG + Intergenic
924986236 2:272434-272456 CAACCAGAAGTGAAACAAAATGG - Intronic
925921140 2:8638758-8638780 CCACCCAAAGTGCTAGAAACAGG - Intergenic
926059037 2:9793848-9793870 CAGCCCAAAGTGCCACAGCTCGG + Intergenic
926857072 2:17268641-17268663 CATAACAAAGTACCACAAAATGG + Intergenic
927512290 2:23651670-23651692 CATCACAAAATGCCACAAATTGG + Intronic
928332026 2:30364916-30364938 CAACCTCCAGTGCCACAGAAAGG - Intergenic
928403631 2:30997274-30997296 GAGCCCAAAGTGCCACAGGAGGG + Intronic
928483381 2:31706178-31706200 CAACCCAAATTGCTACAAAGGGG - Intergenic
928777292 2:34780950-34780972 CAATCCAAAGTGTCACAGACAGG + Intergenic
931358999 2:61562302-61562324 CTACCCCAAGTGCCACAACATGG - Intergenic
932660805 2:73650155-73650177 CAACCGAAAGTGCAACAAGAGGG + Intergenic
932668076 2:73713151-73713173 CAACCTAAAGTGCAACAAGAGGG + Intergenic
934774186 2:96926895-96926917 CTACCCACAGTGCCTCACAATGG - Intronic
935504676 2:103885468-103885490 CACACCAAAGTGCCACAATTTGG + Intergenic
935515076 2:104026619-104026641 GAGACCAAAGTGCCACAAAAGGG - Intergenic
936053119 2:109240560-109240582 CAAGTCAAAGTGCCACACCAGGG - Intronic
939029898 2:137059740-137059762 CAAACTATAGTACCACAAAATGG - Intronic
940910420 2:159205180-159205202 AAGCCAAAAGAGCCACAAAAGGG - Intronic
941452310 2:165674259-165674281 CAAACCAAAGTGCCATACAGTGG + Intronic
942119726 2:172764939-172764961 CAAAACAAAGTACCACAAACTGG + Intronic
942188277 2:173445482-173445504 CATAACAAAGTGCCACAAACTGG + Intergenic
942249520 2:174035666-174035688 TAACCCTAAATGCCAAAAAATGG - Intergenic
944049172 2:195447473-195447495 CAACTTAAAATGCCATAAAAAGG - Intergenic
945802682 2:214452658-214452680 AATGCCAAAGTGCCTCAAAATGG + Intronic
945883891 2:215354401-215354423 AAACCCAGAGTGCCAACAAAGGG - Intergenic
945965912 2:216186315-216186337 CCACCCAAAGTCCTATAAAATGG - Intronic
947109746 2:226706215-226706237 CAGGGCAAAGTGCCACAAACTGG - Intergenic
947295209 2:228623367-228623389 CAACCCAAATTTCCACCAAGAGG + Intergenic
947702023 2:232242522-232242544 CAACACAAAGGGCCACAGAAGGG - Intronic
948398045 2:237661976-237661998 CATAACAAAGTGCCACAAACTGG + Intronic
1168923760 20:1563005-1563027 AAACGCAAACTGCCACAAATGGG + Intronic
1169114024 20:3051244-3051266 CCCACCATAGTGCCACAAAAGGG + Intergenic
1169148379 20:3269600-3269622 CAAAACAAAATGCCTCAAAATGG + Intronic
1169710346 20:8554348-8554370 CAACCCAAATTTCCACCAACTGG + Intronic
1170280767 20:14645640-14645662 CAAACCAAAGTGCTACATTATGG - Intronic
1171183803 20:23110650-23110672 CAAAACAAAGTACCACAAACTGG + Intergenic
1173110390 20:40182150-40182172 TGTTCCAAAGTGCCACAAAATGG + Intergenic
1176713792 21:10331740-10331762 GAACCCAAAGTTTCACAAAAGGG + Intergenic
1179390357 21:40983368-40983390 CAACCAACAGCCCCACAAAAAGG + Intergenic
1183612756 22:38921684-38921706 CAAGGCAAAGTGCCTCAAATAGG + Intergenic
1183969727 22:41468043-41468065 CCAGCAAAAGTGCCACAAAGAGG - Intronic
949426571 3:3923536-3923558 CAAAACAAAGTACCACAAACTGG - Intronic
949581475 3:5392731-5392753 CAACCCACAGTGCCAAGAGACGG - Intergenic
951169878 3:19528740-19528762 CAACCAAAAGTCCTTCAAAATGG + Intronic
951781694 3:26370523-26370545 CAAAACAAAGTGCAATAAAATGG - Intergenic
954056261 3:48028472-48028494 AAAACAAAAGTACCACAAAATGG + Intronic
955414921 3:58683312-58683334 GAACCACAAGTGCCACAAGAAGG + Intergenic
955876930 3:63500498-63500520 CAAACCAAAGTGTGTCAAAATGG + Intronic
955962351 3:64353643-64353665 CAACCCCAATTGTAACAAAATGG - Intronic
961678187 3:128580964-128580986 CAACCCAAACTGACATAAAGAGG - Intergenic
963129624 3:141846270-141846292 CAACCCAGACGGCCACAATAAGG + Intergenic
963255271 3:143138716-143138738 TTACCCAAAGTTCCACAAAGGGG - Intergenic
965211777 3:165799543-165799565 CAACCAAATGTGCCACATTAAGG + Intronic
966740677 3:183230481-183230503 CAACCCAAATGTCCATAAAAAGG - Intronic
968280116 3:197470805-197470827 CAAAACAAAGTGCCACAAATTGG + Intergenic
969873721 4:10120680-10120702 CAAACCAGTGTGCAACAAAATGG - Intergenic
971201510 4:24513407-24513429 AAGCACTAAGTGCCACAAAATGG - Intergenic
971394005 4:26212096-26212118 TAACAAAAAGTGCCACAAACTGG - Intronic
971942392 4:33232767-33232789 CTACATATAGTGCCACAAAAAGG - Intergenic
972407377 4:38759748-38759770 CAACCCAAAATTTCACACAAGGG + Intergenic
973957394 4:56076309-56076331 CATAACAAAGTGCCACAGAATGG - Intergenic
974068763 4:57105077-57105099 CTTCCCCAACTGCCACAAAAGGG - Intronic
974836964 4:67262735-67262757 CACAACAAAGTACCACAAAAAGG + Intergenic
975099314 4:70494285-70494307 CAAAACAAAGTACCACAAACTGG + Intergenic
976694750 4:87907596-87907618 TCACCAAAAGTGCCACAAATTGG + Intergenic
977150860 4:93509753-93509775 CAAGTCAAAGTGTTACAAAATGG - Intronic
977185748 4:93933282-93933304 CAACACAAAGTTCAAAAAAACGG + Intergenic
979015671 4:115430483-115430505 CAAATGAAAGTGCCACATAAAGG + Intergenic
980325653 4:131341816-131341838 CAAGCCAAAGAGGCAGAAAACGG + Intergenic
980488213 4:133487873-133487895 AAACCAAAAGTAACACAAAAAGG + Intergenic
983236208 4:165182459-165182481 TAACCCAAACTGCCACATATAGG + Intronic
984805967 4:183752179-183752201 CAAACCTAAGTACCACAAACTGG + Intergenic
984808926 4:183776609-183776631 CTAGCCAGGGTGCCACAAAAGGG + Intergenic
986055447 5:4132367-4132389 CAAACCAACGTGCCACAGATTGG + Intergenic
986550544 5:8949517-8949539 CATAACAAAGTGCCACAAATGGG - Intergenic
988991686 5:36677765-36677787 CATACCAAAGTGCCAGAAGAAGG + Intronic
989563811 5:42880952-42880974 AAACTCAAAGTCCCAGAAAAGGG - Intronic
990057707 5:51604804-51604826 TAAAACAAAGTGCCACAAAGAGG - Intergenic
991292907 5:65050133-65050155 CAAAATAAAGTGCCACAAACTGG + Intergenic
992173379 5:74125748-74125770 CTACTCATAGTACCACAAAATGG - Intergenic
992363076 5:76062535-76062557 CAAATCAAAGTACCACAAACTGG - Intergenic
994705303 5:103197316-103197338 CTACCAAAAGTATCACAAAAAGG - Intronic
995416073 5:111914743-111914765 CAAGCTGAAGTTCCACAAAATGG + Intronic
997444409 5:133930959-133930981 CAACCCAAATAGCCCAAAAAAGG + Intergenic
997735003 5:136206647-136206669 CAACCCAAGGTGAAACATAAGGG - Intergenic
998671438 5:144358632-144358654 CAAACCACAATGCCACAAACTGG + Intronic
999798110 5:155006858-155006880 CAACCCAAAGTGCCCATCAATGG - Intergenic
1000015068 5:157268637-157268659 CCACCAAAAGCGTCACAAAATGG + Intronic
1001165463 5:169361582-169361604 CAAAACAAAGTACCACAAACTGG - Intergenic
1003367553 6:5490030-5490052 CAACCGAAAGGGCCACAAGGAGG - Intronic
1007133058 6:39495111-39495133 ATTCCCAAAGAGCCACAAAATGG + Intronic
1007526774 6:42502887-42502909 CATCACAAAGTACCACAAACTGG - Intergenic
1011140215 6:84146203-84146225 CAACACAAAGTAACTCAAAATGG - Intronic
1011529015 6:88299617-88299639 CATCACAAAGTACCACAAACTGG + Intergenic
1012731811 6:102892803-102892825 CATAACAAAGTGCCACAGAATGG + Intergenic
1013387064 6:109642238-109642260 CATAACAAAGTGCCACAAACTGG - Intronic
1014038105 6:116791382-116791404 CAACAGAAAGTGCGACAAGAAGG - Intergenic
1015798505 6:137036758-137036780 CATGGCAAAGTGCCACAAACTGG - Intronic
1016645402 6:146401404-146401426 AAACCAACAGTGCCACGAAATGG + Intronic
1017045501 6:150343914-150343936 CCACCCTCAGTGCCACAAGAGGG - Intergenic
1017222231 6:151979206-151979228 TAACCCCTAGTGCCTCAAAATGG - Intronic
1017433219 6:154391638-154391660 AGACACAAAGTGACACAAAATGG - Exonic
1017575066 6:155793179-155793201 AAACACAAAGTAACACAAAAAGG + Intergenic
1019140873 6:169941321-169941343 CAACCCACTGGTCCACAAAAGGG + Intergenic
1021454750 7:20817843-20817865 CAAGACAAAGTGCCTCAAATTGG + Intergenic
1021814522 7:24434225-24434247 CATAGCAAAGTGCCACAAACTGG - Intergenic
1021972629 7:25980746-25980768 CAAAACAAAGTGCCACAGACTGG - Intergenic
1022186664 7:27975992-27976014 CAAGCCAAAATGTCACATAAGGG + Intronic
1022311691 7:29202455-29202477 CATCCTCAAGTGCAACAAAATGG + Intronic
1023286392 7:38625222-38625244 CAGCCCAGATTACCACAAAAGGG + Intronic
1024117741 7:46209380-46209402 CACCACAAAGTGCCACACAGTGG + Intergenic
1025042818 7:55662733-55662755 CACCCAAATGTGCCACACAAGGG + Intergenic
1026207848 7:68273704-68273726 AAGCATAAAGTGCCACAAAATGG - Intergenic
1026549094 7:71351777-71351799 CATAGCAAAGTACCACAAAATGG - Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028480852 7:91303069-91303091 CAAACCAAAGTGACTGAAAATGG - Intergenic
1029505993 7:100964600-100964622 CAACCCAAAGTGCACCAGAAGGG - Intronic
1030201478 7:106909842-106909864 CATAACAAAGTGCCACAAACTGG - Intergenic
1030829695 7:114206040-114206062 GAACCTAAAGTACCATAAAAAGG + Intronic
1031432959 7:121695546-121695568 CAAAACAAAGTACCACAAATTGG + Intergenic
1031455386 7:121972886-121972908 CAACCCAAAGTGCCACAAAATGG + Intronic
1031542590 7:123013114-123013136 CAACTCAAAGTGAGAAAAAAGGG + Intergenic
1031737682 7:125386845-125386867 CAACAGAAAATGCCTCAAAAGGG - Intergenic
1032198364 7:129802455-129802477 CAACCCGAATGTCCACAAAAGGG - Intergenic
1032292708 7:130603425-130603447 ATGCCCAAATTGCCACAAAATGG - Intronic
1032541710 7:132708338-132708360 CATCATAAAGTGCCACAAACTGG - Intronic
1035968263 8:4219139-4219161 CAACACCAGGTGCTACAAAAAGG - Intronic
1041835932 8:62215317-62215339 GAACCCAAAGTTTCACAAAAGGG - Intergenic
1042091343 8:65162934-65162956 CAAACATAAGTGACACAAAATGG + Intergenic
1043693581 8:83188743-83188765 CATCATAAAGTGCCACAAACTGG - Intergenic
1046444184 8:114294733-114294755 CAACCCAAAGGGGCTCAAAGTGG - Intergenic
1047567237 8:126059211-126059233 CAACCCCCAGTACCTCAAAATGG + Intergenic
1047723553 8:127665180-127665202 CATACCAAAGTACCACAAACTGG - Intergenic
1047974859 8:130120015-130120037 CAACCCAAAATGAAAGAAAAAGG - Intronic
1048924047 8:139254774-139254796 CACCCCCAAGTGCGACTAAAAGG - Intergenic
1050683872 9:8145484-8145506 CATCACAAAGTACCACAAACTGG - Intergenic
1052296002 9:26896419-26896441 CATAACAAAGTGCCACAAACTGG - Intergenic
1057738959 9:97694848-97694870 CAACCCAAATAGCCACCAAAAGG + Intronic
1058766011 9:108183362-108183384 CAGGACAAAGTGCCACAAACTGG + Intergenic
1061770161 9:132913472-132913494 TAACCCAAAGTTCAACCAAAGGG - Intronic
1061770271 9:132914334-132914356 TAACCCAAAGTTCAACCAAAGGG + Intronic
1062737430 9:138145027-138145049 CGTAACAAAGTGCCACAAAATGG + Intergenic
1185690826 X:2153965-2153987 CAAAGCAAACTGCCACAAACTGG - Intergenic
1185922056 X:4104244-4104266 CATGGCAAAGTGCCACAAACTGG - Intergenic
1186398418 X:9233985-9234007 CCACCCAAAGTGCCACAGAATGG - Intergenic
1187829237 X:23363942-23363964 CAACCCAAAGGTCCACCAACAGG + Intronic
1188462500 X:30444981-30445003 CTGCCCAAAGGGCCACAAAAAGG - Intergenic
1193140454 X:78021480-78021502 CAACCTTAAGTTACACAAAATGG - Intronic
1193999838 X:88414236-88414258 CAACACAAAGTACCTCAGAAAGG + Intergenic
1196091644 X:111750451-111750473 TAAAGCAAAGTGCAACAAAATGG - Intronic
1196510580 X:116506349-116506371 CAACCCAAAGGACCAGAAAAGGG - Intergenic
1198833158 X:140772732-140772754 CAACTCAAAATGCCACAATAGGG + Intergenic
1198899671 X:141496484-141496506 AAATCCACAGAGCCACAAAATGG + Intergenic
1199237136 X:145504953-145504975 CAACCCAAAGGGACACCAAAGGG + Intergenic
1200399586 X:156011242-156011264 CGTAACAAAGTGCCACAAAATGG + Intergenic