ID: 1031459690

View in Genome Browser
Species Human (GRCh38)
Location 7:122032524-122032546
Sequence CCCTAACCCCAGTGGCTCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031459684_1031459690 18 Left 1031459684 7:122032483-122032505 CCCCACTAGAGAGCTTCATATTG 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1031459690 7:122032524-122032546 CCCTAACCCCAGTGGCTCTGCGG No data
1031459683_1031459690 23 Left 1031459683 7:122032478-122032500 CCATTCCCCACTAGAGAGCTTCA 0: 1
1: 0
2: 1
3: 15
4: 151
Right 1031459690 7:122032524-122032546 CCCTAACCCCAGTGGCTCTGCGG No data
1031459686_1031459690 16 Left 1031459686 7:122032485-122032507 CCACTAGAGAGCTTCATATTGCA 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1031459690 7:122032524-122032546 CCCTAACCCCAGTGGCTCTGCGG No data
1031459685_1031459690 17 Left 1031459685 7:122032484-122032506 CCCACTAGAGAGCTTCATATTGC 0: 1
1: 0
2: 0
3: 2
4: 76
Right 1031459690 7:122032524-122032546 CCCTAACCCCAGTGGCTCTGCGG No data
1031459682_1031459690 30 Left 1031459682 7:122032471-122032493 CCGCTGGCCATTCCCCACTAGAG 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1031459690 7:122032524-122032546 CCCTAACCCCAGTGGCTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031459690 Original CRISPR CCCTAACCCCAGTGGCTCTG CGG Intronic
No off target data available for this crispr