ID: 1031466115

View in Genome Browser
Species Human (GRCh38)
Location 7:122114358-122114380
Sequence TAGGAGCAACAACATCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031466115 Original CRISPR TAGGAGCAACAACATCACCA GGG (reversed) Intronic
901870426 1:12135555-12135577 CAAGAGCAGCAACTTCACCAAGG - Intronic
902201539 1:14837188-14837210 CAGCAGCAACAACAACAGCAGGG - Intronic
902951516 1:19886834-19886856 TAGGAGCATCAGCATCCCCTGGG - Intronic
907042859 1:51279007-51279029 TAGGAGCAACAATACCATCTAGG - Intergenic
907788045 1:57633389-57633411 CAGCAGCATCAGCATCACCAGGG - Intronic
909954073 1:81755888-81755910 CATCAGCACCAACATCACCAGGG + Intronic
909998751 1:82315559-82315581 CAGCAGCAGCAACATCACCTGGG - Intergenic
910288304 1:85577551-85577573 CAGCAGCATCAACATCACCTGGG + Intronic
910863876 1:91769533-91769555 CATGACCAACAACATCTCCAAGG + Intronic
912780187 1:112539237-112539259 TAGGAGCATCACCATCACCCAGG - Intronic
913290408 1:117266698-117266720 TAGGAGCATCAGCATCACCAGGG + Intergenic
916383037 1:164234414-164234436 TATCAACAACAGCATCACCAGGG + Intergenic
918623528 1:186632579-186632601 CAGAAGCAACAACATCCGCAGGG - Intergenic
918632636 1:186736426-186736448 TAGGAGGAACATCATTACCCTGG + Intergenic
1063433446 10:6011368-6011390 TAGCAGCAGCAACAGCACCTGGG + Exonic
1064862749 10:19845644-19845666 AAGGAGCTGCAACATCACCAGGG - Intronic
1064882363 10:20070334-20070356 TTGAAGCAACAAAATCACCAAGG - Intronic
1065262593 10:23939478-23939500 TAGGAGAAAGAATATCACCAAGG + Intronic
1069331912 10:67302960-67302982 CAGCAGCACCAACATCACCTGGG + Intronic
1069952092 10:72026076-72026098 CAGCAGCATCAGCATCACCAGGG - Intergenic
1070401045 10:76053861-76053883 TAGCAGCATCAGCATCACCTGGG + Intronic
1070533231 10:77355654-77355676 TTGGCTCAACAATATCACCAAGG - Intronic
1070908830 10:80099744-80099766 CAGCAGCATTAACATCACCAGGG - Intergenic
1071394134 10:85205054-85205076 TTGGAGCAACAACTACACGAAGG - Intergenic
1073620564 10:105043267-105043289 TAGCAGCATCAGCATCACCTGGG + Intronic
1074430995 10:113394565-113394587 TAGCAGCAACAGCATCACCTGGG - Intergenic
1074434560 10:113422938-113422960 GAGGATCAACTAGATCACCAGGG - Intergenic
1075862682 10:125690696-125690718 TAGCAGCATCAATATCACCTGGG + Intergenic
1076577436 10:131478990-131479012 GAGGAGGAAGAACATCACCATGG + Intergenic
1078820427 11:14875007-14875029 TAGGAGCACCACCATCTCCTTGG + Intergenic
1079066571 11:17299310-17299332 TGGAAGCATCAGCATCACCAGGG - Intronic
1079378496 11:19915738-19915760 AAGGACCAACAAGATAACCACGG - Intronic
1079442679 11:20531131-20531153 CAGCAGCAACAGCATCACCTCGG - Intergenic
1080986081 11:37467691-37467713 TAGAAGCAGCAGCATCACCTGGG + Intergenic
1081002165 11:37688513-37688535 TAGCAGCACCAGCAGCACCAGGG + Intergenic
1082936747 11:58663716-58663738 TATGAGCAACAATATCGCAAGGG + Intronic
1083824509 11:65191319-65191341 TATGAGCAACAAGATCACTTGGG - Intronic
1085506293 11:77062335-77062357 TAAGATCAAGAACATCACAAGGG - Intergenic
1085783155 11:79427588-79427610 TAGGAGAAACTACCTCTCCATGG + Intronic
1085851021 11:80120219-80120241 TAGCAGCATCAGCATCACCTGGG + Intergenic
1086943228 11:92819460-92819482 CAGCAGCATCAACATCACCTGGG - Intronic
1086943652 11:92823578-92823600 TAGGAGCAACAACATGATTGTGG - Intronic
1087274857 11:96150896-96150918 TAGCAGCATCAGCATCACCTGGG + Intronic
1089009724 11:115122569-115122591 TAGGAGCAGCACCTTCCCCAGGG - Intergenic
1089429887 11:118414112-118414134 CAGCAGCATCAGCATCACCAGGG + Intronic
1089671257 11:120058482-120058504 TAGAAGCCACCACGTCACCAAGG + Intergenic
1089996949 11:122917461-122917483 CAGGAGCATCATCATCACCTGGG + Intronic
1093820074 12:23604437-23604459 TAGGAGATACAGCAGCACCAAGG + Exonic
1095601174 12:44014491-44014513 TAGGAGCATCAGCATCACCTGGG - Intronic
1097014625 12:55976616-55976638 TAGGAGAACCATCATCATCATGG - Intronic
1097814791 12:64060531-64060553 TAGCAGCAATGGCATCACCAGGG - Intronic
1099161720 12:79249708-79249730 TAGGAGTAAAGTCATCACCAAGG - Intronic
1099180275 12:79468142-79468164 TATTAGGAACAACATCACAATGG - Intergenic
1099359874 12:81686987-81687009 CAGCAGCAGCAACATCACCTAGG + Intronic
1099470864 12:83046333-83046355 TGGCAGCATCAGCATCACCAGGG + Intronic
1099987579 12:89685510-89685532 TAGCAGTATCAGCATCACCATGG + Intronic
1100257463 12:92899024-92899046 TAGTAGCAACCACCACACCAAGG + Intronic
1100709833 12:97243881-97243903 TACGAGTAACAACACCACCTGGG - Intergenic
1100803873 12:98261157-98261179 CAGCAGCAGCAACATCACCTGGG + Intergenic
1102100406 12:110274057-110274079 TAGCAGCATCAACATCACCGGGG + Intergenic
1102225478 12:111225308-111225330 TAGGAGCAGAAACTTCATCATGG - Intronic
1102577662 12:113866610-113866632 TGGTAGCATCAGCATCACCAGGG + Intronic
1102724154 12:115043925-115043947 CGGCAGCATCAACATCACCAGGG - Intergenic
1103128230 12:118443370-118443392 CAGCAGCAACAACATCACCTGGG - Intergenic
1103159734 12:118719085-118719107 AAGTAGCATCAACATCACCTGGG + Intergenic
1104023273 12:125008098-125008120 TAGCAGCAGCAGCATCACCCAGG - Intronic
1104547327 12:129724027-129724049 TGGGTCCAATAACATCACCAGGG + Intronic
1105293279 13:19067939-19067961 TAAGAGTGACATCATCACCATGG + Intergenic
1105539257 13:21300705-21300727 GAGGAGAAATAACATGACCAGGG + Intergenic
1105798987 13:23886913-23886935 GAGGAGAAATAACATGACCAGGG - Intronic
1106837076 13:33645868-33645890 TATCAGCAGCAATATCACCAAGG + Intergenic
1108225115 13:48281362-48281384 CAGCAGCAGCAACATCACCTGGG - Intergenic
1108772960 13:53727832-53727854 CAGCAGCATCAACATCACCTGGG - Intergenic
1109354392 13:61220216-61220238 TAGCAGGAACAACATCACAGGGG - Intergenic
1110435102 13:75470385-75470407 TGGCAGCATCAACATCACCTGGG + Intronic
1110572330 13:77019558-77019580 TAGCAGCATCAACATCACCTGGG + Intronic
1112555199 13:100461166-100461188 TAGTAGCAATAACAACCCCACGG - Intronic
1114958692 14:27854928-27854950 TAGGTGCAGCAAATTCACCATGG + Intergenic
1115380668 14:32735093-32735115 TAAAATCAACAACATCACCAAGG + Intronic
1115503174 14:34067215-34067237 CAGCAGCATCAACATCACCTGGG - Intronic
1120867660 14:89309557-89309579 TTGGAGCAACAGCAAAACCAAGG + Intronic
1121081874 14:91114908-91114930 TGGGAGCATCAACACCAACATGG + Intronic
1121236665 14:92396428-92396450 AAGGAGGAACAACAGCACCTTGG - Intronic
1202847383 14_GL000009v2_random:192258-192280 TAGCAGCATCAGCATCACCTGGG - Intergenic
1202875939 14_KI270722v1_random:380-402 TAGCAGCAACAGCATCACCTGGG + Intergenic
1124833433 15:33172502-33172524 GAGGAGCAACTTAATCACCAAGG + Intronic
1126328764 15:47509775-47509797 TAGGAACATCAACATCACCTAGG + Intronic
1126358977 15:47825907-47825929 TAGGATCAACATCATCATAAGGG - Intergenic
1126944195 15:53800590-53800612 TAGGAGCAACAAGGTGACTATGG + Intergenic
1127540371 15:59932012-59932034 CAGCAGCATCAACATCACCTGGG + Intergenic
1129448368 15:75634676-75634698 TAGCAGCACCAAAATCACCTGGG + Intergenic
1130839838 15:87687917-87687939 TAGCAGCATCAGCATCACCCAGG + Intergenic
1131348890 15:91678506-91678528 TAGCAGCAGAAGCATCACCAGGG + Intergenic
1131713792 15:95086455-95086477 AAGCAGCAACAATATCCCCAGGG - Intergenic
1132197400 15:99926169-99926191 CAGCAGCAACAACGTCACCTGGG - Intergenic
1133124999 16:3641058-3641080 CAGGAGCAGCAACAGCACCTGGG - Intronic
1134313323 16:13095956-13095978 CAGCAGCAACAGCATCACCTGGG - Intronic
1134478394 16:14596087-14596109 TAGAAGCAATAATATCACCTAGG + Intronic
1135795164 16:25434429-25434451 TAGGAGGAACAAGATAACAAGGG - Intergenic
1136086351 16:27888059-27888081 TAGGAGCATCAGCATCTCCGAGG - Intronic
1136638156 16:31539013-31539035 TAGGTGCAGCAAAATCACAAGGG - Intergenic
1137604641 16:49779417-49779439 CAGCAGCATCAACATCACCCTGG + Intronic
1138338188 16:56269279-56269301 GAGCAGCAACAACAGCAGCAAGG - Intronic
1140627201 16:76808337-76808359 CAGCAGCATCAACATCACCTAGG - Intergenic
1140785353 16:78336140-78336162 AAGTAGCATCAACATCACCTGGG - Intronic
1141262565 16:82467228-82467250 CAGCAGCATCAACATCACCTGGG - Intergenic
1144274735 17:13655366-13655388 AAGTAGAAACAAGATCACCAGGG - Intergenic
1144406815 17:14959874-14959896 TAGCAGTATCAACATCACCTGGG + Intergenic
1146488937 17:33265991-33266013 AAGGAGCAGCAAGACCACCATGG - Intronic
1146669582 17:34727476-34727498 AAGTAGCACCAACATCACCTTGG - Intergenic
1148490665 17:48022051-48022073 AGGGAGCAACAACATAAGCAAGG - Intergenic
1148885619 17:50770172-50770194 TAGAAGCAATGACATCTCCATGG - Intergenic
1151003317 17:70403721-70403743 TAGCAGCATCAGCATCACCTAGG - Intergenic
1151367120 17:73624813-73624835 TCCTAGTAACAACATCACCACGG - Intronic
1155718076 18:28971525-28971547 CAGCAGCATCAACATCACCTGGG + Intergenic
1155728101 18:29115394-29115416 TAGAAGCAGCAACATCACGCAGG + Intergenic
1156548121 18:37986367-37986389 TAGGATCTAAAATATCACCATGG + Intergenic
1157525316 18:48376091-48376113 TAGCAGCATCCACATCACCTGGG - Intronic
1157818754 18:50750278-50750300 TAGGAACAACAGCAGCACCAAGG - Intergenic
1157991115 18:52497759-52497781 CAGTAGCAGCAGCATCACCACGG + Intronic
1158627642 18:59085268-59085290 TATGCGCAACAGCATCACCTGGG + Intergenic
1160601182 18:80013851-80013873 TAGGAACAACAACAACAAAAAGG + Intronic
1160856739 19:1221207-1221229 ATGAAGCTACAACATCACCACGG + Exonic
1163006930 19:14402760-14402782 TCTGAGCCACAACAACACCAAGG + Exonic
1166244056 19:41513325-41513347 TATTAGAAACAACATCACAAGGG + Intergenic
1202674726 1_KI270710v1_random:32430-32452 TAGCAGCAACAGCATCACCTGGG - Intergenic
925131875 2:1499531-1499553 TGGCTGCAGCAACATCACCAAGG + Intronic
925131888 2:1499604-1499626 CTGCAGCAACAACATCACCAAGG + Intronic
925355179 2:3236004-3236026 TAAGAGCAACATCAACACCCGGG + Intronic
927608103 2:24507033-24507055 TAGTAGTAACAACATCAACAAGG - Intronic
931135759 2:59398835-59398857 TAGGAGCAAGAACAAGAGCAGGG + Intergenic
932592049 2:73073532-73073554 TAGGAGAAGAAACATCAACAAGG + Exonic
932965349 2:76468220-76468242 CAGCAGCAACAACATCAACTTGG - Intergenic
933358366 2:81244207-81244229 AAGGAGAAATAACCTCACCAAGG + Intergenic
933870535 2:86561433-86561455 CAGCAGCATCAACATCACCTGGG + Intronic
933870602 2:86562422-86562444 CAGCAGCATCAACATCACCTGGG - Intronic
934930623 2:98419654-98419676 CAGCAGCATCAGCATCACCAGGG - Intergenic
935557489 2:104526250-104526272 CAGCAGCATCAGCATCACCAGGG - Intergenic
937672910 2:124557903-124557925 TAGGAACAACAAAGTCAACATGG + Intronic
938722982 2:134082960-134082982 TGGAAGCAAGAACATCATCATGG + Intergenic
941533612 2:166696908-166696930 TATGAGGAACAATATCACAAGGG - Intergenic
941894391 2:170614670-170614692 CAGCAGCATCAACATCACCTGGG - Intronic
944005646 2:194902106-194902128 TAGGAGCAAAAACATCATAATGG - Intergenic
944295995 2:198062991-198063013 TGCCAGCAACAGCATCACCAAGG - Intronic
944341780 2:198609961-198609983 TAGGAGCAACAGCATCTCCTGGG - Intergenic
944530488 2:200663130-200663152 TGGCAGCAACCAGATCACCAAGG - Intronic
944983882 2:205152952-205152974 TAGGAGCAACATCAACAAAAAGG - Intronic
947531991 2:230915145-230915167 CATCAGCATCAACATCACCATGG + Intronic
948244466 2:236467367-236467389 TAGGAGAAAAAAAATCACTATGG + Intronic
1168948445 20:1780462-1780484 TAGAATCAAGATCATCACCATGG - Intergenic
1169333232 20:4732918-4732940 CAGCAGCATCAACATAACCAGGG - Exonic
1169739131 20:8870953-8870975 CAGCAGCAACAGCATCACCTTGG + Intronic
1169748388 20:8965943-8965965 CAGCAGCAACAGCATCACCAGGG + Intronic
1169868882 20:10230497-10230519 TAGCAGCATCAGCATCACCCAGG + Intronic
1170451677 20:16489825-16489847 TAGCAGCATCAACATCACCGGGG - Intronic
1172004726 20:31811224-31811246 CAGCAGCAACAGCATCATCAGGG + Intergenic
1173100518 20:40083748-40083770 CAGCAGCATCAACATCACCTGGG + Intergenic
1173973936 20:47173179-47173201 TAGCAGCGACAGCATCACCTGGG + Intronic
1175435685 20:58945944-58945966 TAGGAACCTCGACATCACCATGG + Intergenic
1176637212 21:9257750-9257772 TAGCAGCAACAGCATCACCTGGG + Intergenic
1176864274 21:14035040-14035062 CAGCAGCATCAACATTACCAGGG + Intergenic
1178441573 21:32602722-32602744 TAGGAGCACCCACAAAACCAAGG + Intronic
1181077387 22:20390259-20390281 TAGGAACAAGAACATGACCTGGG + Intronic
1181602963 22:23963252-23963274 TGGGAGTATCAGCATCACCAGGG + Intergenic
1181605551 22:23978055-23978077 TGGGAGTATCAGCATCACCAGGG - Intronic
949326965 3:2876945-2876967 CAGCAGCATCAACATCACCTTGG + Intronic
949746190 3:7294720-7294742 TAGCAGCATCAGCATCACCTGGG + Intronic
949864763 3:8538302-8538324 CAGTAGCATCAACATCACCTGGG - Intronic
950400384 3:12765365-12765387 TGGGAACACCAACATCACCTTGG + Intronic
950667428 3:14505873-14505895 GAGGAGCAACGACCTCCCCAGGG - Intronic
950808512 3:15629275-15629297 CAGGAGCATCAGCATCACCTTGG + Intronic
950918344 3:16667739-16667761 CAGGAGCATCAGCATCACCTGGG + Intronic
951834295 3:26964007-26964029 TAGCACCATCAACATCACCCAGG + Intergenic
952062841 3:29531201-29531223 CAGGAGCATCAGCATCACCTGGG + Intronic
952844698 3:37677947-37677969 TAGGAGCAATATCATAACTAGGG - Intronic
954837275 3:53480825-53480847 TAGAAACATCAACATCACCTGGG + Intergenic
955978632 3:64501999-64502021 CAGCAGCATCAACATCACCTGGG - Intergenic
955981243 3:64529742-64529764 CAGGGGCATCAGCATCACCAGGG + Intronic
956362212 3:68460800-68460822 TAGCAGCATCAGCATCACCTGGG - Intronic
956663848 3:71623998-71624020 CAGCAGCAGCAACATCACCCAGG + Intergenic
956836377 3:73099530-73099552 TAGGAGCATCAACGTCACCTGGG + Intergenic
956847974 3:73201517-73201539 TAGGAGCAATATAATCACCAGGG + Intergenic
956874413 3:73447768-73447790 TAGGAGAAAGAACATCAACATGG - Intronic
957103680 3:75859195-75859217 TAGCAGCATCAGCATCACCTGGG - Intergenic
958060616 3:88475062-88475084 TAGGAGTATCAGTATCACCAAGG + Intergenic
958702807 3:97615539-97615561 TAGGTACAACAATGTCACCAGGG - Intronic
959042067 3:101432878-101432900 TACTAGCATCAACATCACCAAGG + Intronic
959664621 3:108906646-108906668 TAAGAGCCAGAACATCAGCAAGG - Intergenic
960485330 3:118245316-118245338 AAGGAGGAAGCACATCACCAAGG + Intergenic
960993696 3:123327740-123327762 TAGACGCATCCACATCACCAAGG - Exonic
961271542 3:125693139-125693161 TAGTAGCAACAATATCACACGGG + Intergenic
961375826 3:126465215-126465237 GAGGAGCGACAACCGCACCAGGG + Intronic
961993990 3:131221443-131221465 TAGCAAGAACAACATCACCTGGG - Intronic
962199560 3:133390250-133390272 CTGGAACAACACCATCACCATGG + Exonic
962625841 3:137225054-137225076 CAGCAGCAACAGCATCACCTGGG + Intergenic
962842369 3:139247149-139247171 TAGGAGCAACAACAGGACACTGG - Intronic
963524698 3:146403452-146403474 CAGCAGCATCAACATCACCTGGG - Intronic
963860621 3:150306277-150306299 TATGAGCAGCAAATTCACCATGG + Intergenic
964405385 3:156343310-156343332 CAGCAGCAACAGCATCACCTGGG - Intronic
966499636 3:180625373-180625395 TATGAGCAAAAAATTCACCAAGG - Intronic
967112589 3:186307302-186307324 TAGGATAAATAAAATCACCAAGG - Intronic
967429116 3:189361242-189361264 CAGTAGCATCAGCATCACCAAGG - Intergenic
967655442 3:192042780-192042802 TAGGCCCAACATAATCACCAAGG + Intergenic
967669846 3:192219615-192219637 TAACAGCACCAACATCACCTGGG + Intronic
968316185 3:197727632-197727654 GAGGACCAACAGCATCAACAGGG - Intronic
1202749682 3_GL000221v1_random:147269-147291 TAGCAGCAACAGCATCACCTGGG - Intergenic
971226770 4:24761311-24761333 TAGCAGCATCAATATCACCTGGG - Intergenic
971532896 4:27711336-27711358 TACCAGCAAGAGCATCACCAGGG - Intergenic
971918574 4:32908192-32908214 AAGGAGAAACAACATGGCCAGGG + Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
974687115 4:65244345-65244367 CAGTAGCATCAACATCTCCAGGG + Intergenic
975569393 4:75797956-75797978 TAGGAGACTCAACATCACAAAGG - Intronic
975774901 4:77775514-77775536 TAGAATCTACATCATCACCATGG + Intronic
978202964 4:106044842-106044864 TAGCAGCAACAACAAAACCATGG + Exonic
978497467 4:109375809-109375831 TTTGAGCAACAAAATCACCTTGG + Intergenic
979352715 4:119664082-119664104 CAGTAGCATCAACATCACCTGGG - Intergenic
979937925 4:126721154-126721176 CAGTAGCAGCAACATCACCTGGG - Intergenic
981985333 4:150847955-150847977 AAGCAGCATCAACATCACCTGGG + Intronic
983000013 4:162402450-162402472 AAGGAAAAACAGCATCACCATGG - Intergenic
983098871 4:163599787-163599809 TAGTAGCATCAAAATCACCTCGG - Intronic
983954277 4:173678474-173678496 TTGTAGCAACAACATCTCCATGG - Intergenic
984795937 4:183659722-183659744 TAGGAGAAACACCGTCCCCATGG - Intronic
1202752105 4_GL000008v2_random:16177-16199 TAGCAGCAACAGCATCACCTGGG + Intergenic
985722825 5:1499612-1499634 TAGGGGCAACAGGATCATCACGG - Intronic
986183300 5:5414309-5414331 TAGGTGCAGCAAAACCACCATGG + Intergenic
987854847 5:23407455-23407477 TAGGAGCAAAGACTTCTCCAGGG - Intergenic
988454165 5:31372859-31372881 TAGGAGGAACAACATCATGATGG - Intergenic
988852439 5:35193034-35193056 TAGGAGCAACAGAGTCACCATGG + Intronic
989621865 5:43392440-43392462 TAGCAGTATCAACATCACCAGGG - Intronic
990238862 5:53797216-53797238 GAGGCTCAACAACATCAGCAAGG + Intergenic
991218064 5:64179019-64179041 AAGGAGCAGCAACAACACCTGGG - Intronic
991357032 5:65779258-65779280 TAGGAGCATCAGCATCACCAGGG - Intronic
992399283 5:76396879-76396901 TAGGAACAAAAAAATCACCAAGG + Intergenic
992465631 5:77001047-77001069 CAGCAGCATCAACATCACCTGGG - Intergenic
994393300 5:99209105-99209127 TATTAGAAACAACATCACCCTGG + Intergenic
994393988 5:99213548-99213570 TATTAGAAACAACATCACCCCGG + Intergenic
995806624 5:116059914-116059936 CAGCAGCATCAACATCACCTGGG - Exonic
997078128 5:130705251-130705273 CAGGAGCATCAGCATCACCTGGG - Intergenic
997673127 5:135692752-135692774 TAGCAGAAACAGCATCACCATGG - Intergenic
997687676 5:135800072-135800094 TATTAGAAACAATATCACCAGGG - Intergenic
997687757 5:135800611-135800633 TATTAGAAACAACATCACCCGGG - Intergenic
997720007 5:136070673-136070695 TATGAGCATCACCATCCCCAGGG + Intergenic
997801152 5:136863948-136863970 AAGCAGCATCAACATCACCTAGG + Intergenic
998355951 5:141536787-141536809 GAGGAGCAAAAACGTCACTAAGG + Intronic
998484209 5:142487434-142487456 GTGGCTCAACAACATCACCACGG - Intergenic
998935757 5:147230575-147230597 TATTAGGAACAACATCACTAGGG - Intergenic
999091396 5:148939354-148939376 CAGCAGCAACAGCATCACCTGGG + Intronic
1000112602 5:158123227-158123249 CAGGAGCACCAGCATCACCTGGG + Intergenic
1001004788 5:168040564-168040586 TAGGAGAAATCACTTCACCAAGG + Intronic
1002006100 5:176236416-176236438 TAGCAGCATCCACATCACCTGGG + Intergenic
1002220279 5:177674221-177674243 TAGCAGCATCCACATCACCTGGG - Intergenic
1002541600 5:179909521-179909543 CAGCAGCATCAACATCACCTAGG - Intergenic
1002763548 6:219682-219704 TAGGACCAACTACCTCTCCAAGG - Intergenic
1003289905 6:4771438-4771460 TAGCAGCAACGGCATCACCTTGG - Intronic
1003989279 6:11469859-11469881 AAGGAGCAAAAACATGAGCATGG + Intergenic
1006677307 6:35773741-35773763 GAGTAGGAACAAGATCACCAGGG - Intergenic
1008014685 6:46505062-46505084 AAGCAGCATCAACATCACCCGGG + Intergenic
1008956857 6:57224918-57224940 GAGGAGGAACAACTTCACAAAGG - Intergenic
1009363844 6:62842991-62843013 TATGAGAAACAATATCACAAGGG - Intergenic
1009368061 6:62871101-62871123 TAGTAGAAACAATATCACAAGGG - Intergenic
1009953203 6:70420204-70420226 TAGGAGAAAGAACATCCTCAGGG + Intronic
1012662980 6:101927041-101927063 TAGGAGCAACTACATCAGAAAGG + Intronic
1013281510 6:108641652-108641674 TGGGAGCAACCAAACCACCAGGG - Intronic
1013440797 6:110165753-110165775 CAGCAGCATCAACATCACCTAGG + Intronic
1013465418 6:110413649-110413671 TATAAGCAACAAGATCTCCATGG + Intronic
1014648736 6:124008653-124008675 TAGAAGCAAGAAGATCAGCAAGG - Intronic
1014700715 6:124684329-124684351 CAGGAGCAACAGCAGCACCAGGG + Intronic
1017163070 6:151383561-151383583 CAGGAGCCAAATCATCACCAGGG - Intronic
1018096125 6:160388465-160388487 TAGCAGCAACAGCATCATCTGGG - Intronic
1020335754 7:7061013-7061035 TATTAGAAACAATATCACCAGGG + Intergenic
1021764340 7:23931680-23931702 AAGCAGCAACAACACTACCAGGG + Intergenic
1022216311 7:28265654-28265676 CAGCAGCATCAACATCACCTGGG - Intergenic
1022288204 7:28975516-28975538 TTGCAGCAACAGCATCACCTGGG + Intergenic
1022480195 7:30738612-30738634 CAGCAGCAGCAGCATCACCAGGG - Intronic
1023109853 7:36798807-36798829 TTGGAGGAAGAATATCACCATGG + Intergenic
1023202230 7:37711272-37711294 TGGCAGCATCAGCATCACCAGGG - Intronic
1023594197 7:41811404-41811426 CAGTAGCATCAACATCACCTGGG + Intergenic
1027527393 7:79287122-79287144 TAGCAGCATCAGCATCACCTGGG + Intronic
1029343528 7:99962877-99962899 TATTAGGAACAACATCACAAAGG - Intergenic
1031221233 7:118968265-118968287 TAGTAGTATCAGCATCACCAAGG - Intergenic
1031466115 7:122114358-122114380 TAGGAGCAACAACATCACCAGGG - Intronic
1031711112 7:125047244-125047266 TAGCATCAACAACATCAAAAAGG + Intergenic
1032264564 7:130362038-130362060 TGGCAGCATCAACATCACCTGGG + Intronic
1033413430 7:141141193-141141215 TTGGAGCAACAAAATAAGCAAGG - Intronic
1033414848 7:141152616-141152638 CAGGAGCAAGAACATTAGCAGGG + Intronic
1036817984 8:11916278-11916300 TAGTAGGAACAATATCACAAGGG - Intergenic
1037087188 8:14867018-14867040 TAGGAGCTAAAATTTCACCAAGG + Intronic
1037602691 8:20411338-20411360 TAGGATCATCAATATCAACATGG + Intergenic
1039230812 8:35445689-35445711 TGGGAACATCAACATCACCTGGG + Intronic
1040287325 8:46107075-46107097 TAGATGCAAAAACATAACCATGG - Intergenic
1040460670 8:47644784-47644806 TAGGAGCATCAAGGTCACCTTGG + Intronic
1040676317 8:49755328-49755350 TAGGAGCATCAGCCTCACCTGGG + Intergenic
1041696316 8:60740788-60740810 GATGAGCAACAGCAGCACCAAGG - Intronic
1042804898 8:72760504-72760526 CAGCAGCAACAGCATCACCTAGG + Intronic
1043627501 8:82280565-82280587 TAGGACAAACCACATCACCTGGG + Intergenic
1043633766 8:82366906-82366928 TATTAGGAACAATATCACCAGGG - Intergenic
1044222715 8:89688136-89688158 AAGCAGCAACACCATCACCTAGG + Intergenic
1044608034 8:94064059-94064081 CAGGAGCAACAGCATCACCTGGG + Intergenic
1045173973 8:99700284-99700306 TAGCAGCATCAGCATCACCTGGG + Intronic
1045206678 8:100049717-100049739 CAGCAGCAAGAGCATCACCAGGG + Intronic
1046226177 8:111284064-111284086 TAGGAGCAACTAAATCTGCATGG - Intergenic
1047315589 8:123730323-123730345 CAGCAGTACCAACATCACCAGGG + Intronic
1047885146 8:129241903-129241925 CAGCAGCAGCAACATCACCTGGG + Intergenic
1048232731 8:132659754-132659776 TAGAAGCAACCACATCACCAGGG + Intronic
1049346685 8:142142929-142142951 TACCAGCACCACCATCACCATGG - Intergenic
1049930909 9:455589-455611 TAGCAGCAGCAGCATCACCTGGG - Intronic
1050799184 9:9587679-9587701 CAGCAGCATCAACATCACCTGGG - Intronic
1050928471 9:11296460-11296482 TAGCAGCAGCAACAGCAGCACGG + Intergenic
1051409520 9:16775076-16775098 TAGCAGCAACAGCATCATCCAGG + Intronic
1052024451 9:23559063-23559085 TAGCAGCATCAGCATCACCTGGG - Intergenic
1052716020 9:32118435-32118457 AAGGAGCCACACCATCATCAGGG + Intergenic
1054981462 9:71211102-71211124 TAGGAGCAACACCCTCAAAAAGG - Intronic
1055082717 9:72282844-72282866 CAGGAGGAGCAACATCACCTGGG + Intergenic
1057618606 9:96616394-96616416 AAGGAGGAAAAACATTACCAAGG + Intronic
1059539572 9:115117264-115117286 TCTGAGCAACAACATCCCCCAGG - Intronic
1059650412 9:116310888-116310910 TAGGAGTAATAACATCTCCATGG + Intronic
1059970267 9:119660127-119660149 TAGGAGACACAACACCTCCAGGG + Intergenic
1060765536 9:126293078-126293100 TAGGAGCAGCAATGTCACCGAGG + Intergenic
1061561268 9:131405429-131405451 TAACAGCAACAAAACCACCAAGG - Intronic
1061839941 9:133352845-133352867 TAGGAACAACTAGAGCACCAAGG + Intronic
1062387018 9:136316606-136316628 TCTGAGCAACAACCTGACCACGG - Intergenic
1203718325 Un_KI270742v1:177357-177379 TAGCAGCAACAGCATCACCTGGG - Intergenic
1203532891 Un_KI270743v1:865-887 TAGCAGCAACAGCATCACCTGGG + Intergenic
1203652539 Un_KI270751v1:141050-141072 TAGCAGCATCAGCATCACCTGGG - Intergenic
1185833392 X:3322286-3322308 CAACAGCAACAACAACACCAAGG - Exonic
1185922651 X:4111300-4111322 TAGCAGCATCAAGATCACCTGGG + Intergenic
1186684014 X:11905376-11905398 TCAGATCAACAATATCACCAAGG - Intergenic
1186839342 X:13469515-13469537 TAGCAGCATCAGCATCACCTTGG - Intergenic
1186926667 X:14340683-14340705 TAGCAGCATCAACATTATCAGGG + Intergenic
1187726158 X:22204214-22204236 CAGCAGCATCAGCATCACCAGGG - Intronic
1187966213 X:24614941-24614963 TAGCAGCAGCAGCATCACCTGGG + Intronic
1188511107 X:30937495-30937517 CAGAAGCAACAGCATCACCTGGG - Intronic
1189005172 X:36986609-36986631 TAGAAGCATCAGCATCACCCGGG + Intergenic
1189043857 X:37571333-37571355 TAGAAGCATCAGCATCACCCGGG - Intronic
1190787869 X:53670412-53670434 TAGGAGTAATAACATATCCATGG - Intronic
1191025823 X:55912103-55912125 CAGCAGCATCAGCATCACCAGGG + Intergenic
1191675952 X:63792726-63792748 TAGCAGCATCAATATCACCTGGG + Intergenic
1192150669 X:68710475-68710497 TAGCAGCATCAACATCACCTGGG - Intronic
1192350946 X:70355660-70355682 TAGGGGTACCAACATCACCTGGG + Intronic
1192847247 X:74919078-74919100 TAGAAGCAACATCCTGACCATGG - Intronic
1193914018 X:87343517-87343539 TATGTCCAACAACATAACCATGG + Intergenic
1194744746 X:97616057-97616079 CAGCAGCATCAGCATCACCAGGG + Intergenic
1195598739 X:106722434-106722456 CAGGAGCATCAGCATCATCAGGG - Intronic
1195760677 X:108243106-108243128 CAGCAGCATCAACATCACCTGGG - Intronic
1196697511 X:118629123-118629145 CAGCAGCATCAACATCACCTGGG - Intronic
1197075948 X:122352199-122352221 TACTAGCAACAACATCATCTAGG + Intergenic
1197319941 X:125016150-125016172 GAAGAACATCAACATCACCATGG + Intergenic
1199394639 X:147320876-147320898 TAGCAGCACCAACATCCCCTGGG - Intergenic
1200329805 X:155283780-155283802 AAGCAGCAACAACAAGACCAGGG - Intronic
1201172476 Y:11282207-11282229 TAGCAGCAACAGCATCACCTGGG - Intergenic
1202025976 Y:20524417-20524439 TAGGTTCGACAACATCACCAAGG - Intergenic
1202429289 Y:24757691-24757713 TAGGAGTAACAAAAACAGCATGG + Intergenic
1202441502 Y:24912399-24912421 TAGGAGTAACAAAAACAGCATGG - Intergenic