ID: 1031466865

View in Genome Browser
Species Human (GRCh38)
Location 7:122123793-122123815
Sequence CTTATGTAAGCTCTGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031466860_1031466865 10 Left 1031466860 7:122123760-122123782 CCATCCCTAGACTTCTCACTCCT 0: 1
1: 0
2: 2
3: 33
4: 403
Right 1031466865 7:122123793-122123815 CTTATGTAAGCTCTGTTTTGTGG No data
1031466858_1031466865 22 Left 1031466858 7:122123748-122123770 CCTCTCATTCCACCATCCCTAGA 0: 1
1: 0
2: 1
3: 16
4: 238
Right 1031466865 7:122123793-122123815 CTTATGTAAGCTCTGTTTTGTGG No data
1031466864_1031466865 -10 Left 1031466864 7:122123780-122123802 CCTGGACTTCTAGCTTATGTAAG 0: 1
1: 0
2: 2
3: 7
4: 99
Right 1031466865 7:122123793-122123815 CTTATGTAAGCTCTGTTTTGTGG No data
1031466863_1031466865 5 Left 1031466863 7:122123765-122123787 CCTAGACTTCTCACTCCTGGACT 0: 1
1: 0
2: 1
3: 24
4: 286
Right 1031466865 7:122123793-122123815 CTTATGTAAGCTCTGTTTTGTGG No data
1031466862_1031466865 6 Left 1031466862 7:122123764-122123786 CCCTAGACTTCTCACTCCTGGAC 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1031466865 7:122123793-122123815 CTTATGTAAGCTCTGTTTTGTGG No data
1031466859_1031466865 13 Left 1031466859 7:122123757-122123779 CCACCATCCCTAGACTTCTCACT 0: 1
1: 0
2: 1
3: 24
4: 294
Right 1031466865 7:122123793-122123815 CTTATGTAAGCTCTGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031466865 Original CRISPR CTTATGTAAGCTCTGTTTTG TGG Intronic
No off target data available for this crispr