ID: 1031470931

View in Genome Browser
Species Human (GRCh38)
Location 7:122168548-122168570
Sequence ACTGGCTTTCCATGTGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031470931_1031470936 27 Left 1031470931 7:122168548-122168570 CCCACACCACATGGAAAGCCAGT No data
Right 1031470936 7:122168598-122168620 TTTGCCAGATTCCAGGAGCCAGG No data
1031470931_1031470937 28 Left 1031470931 7:122168548-122168570 CCCACACCACATGGAAAGCCAGT No data
Right 1031470937 7:122168599-122168621 TTGCCAGATTCCAGGAGCCAGGG No data
1031470931_1031470935 20 Left 1031470931 7:122168548-122168570 CCCACACCACATGGAAAGCCAGT No data
Right 1031470935 7:122168591-122168613 AAACATCTTTGCCAGATTCCAGG No data
1031470931_1031470938 29 Left 1031470931 7:122168548-122168570 CCCACACCACATGGAAAGCCAGT No data
Right 1031470938 7:122168600-122168622 TGCCAGATTCCAGGAGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031470931 Original CRISPR ACTGGCTTTCCATGTGGTGT GGG (reversed) Intergenic
No off target data available for this crispr