ID: 1031472399

View in Genome Browser
Species Human (GRCh38)
Location 7:122182547-122182569
Sequence TTAAGTTAGCAGGTGATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031472399_1031472408 30 Left 1031472399 7:122182547-122182569 CCATTCATCACCTGCTAACTTAA No data
Right 1031472408 7:122182600-122182622 ATACCCAAGTTCTACATTGAGGG No data
1031472399_1031472407 29 Left 1031472399 7:122182547-122182569 CCATTCATCACCTGCTAACTTAA No data
Right 1031472407 7:122182599-122182621 AATACCCAAGTTCTACATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031472399 Original CRISPR TTAAGTTAGCAGGTGATGAA TGG (reversed) Intergenic
No off target data available for this crispr