ID: 1031474446

View in Genome Browser
Species Human (GRCh38)
Location 7:122205344-122205366
Sequence GACAGACCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031474446_1031474449 21 Left 1031474446 7:122205344-122205366 CCAGTAACAGGCCAAGGTCTGTC No data
Right 1031474449 7:122205388-122205410 CTGCAGAAGATGGCAGAGCCTGG No data
1031474446_1031474448 11 Left 1031474446 7:122205344-122205366 CCAGTAACAGGCCAAGGTCTGTC No data
Right 1031474448 7:122205378-122205400 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031474446 Original CRISPR GACAGACCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr