ID: 1031475719

View in Genome Browser
Species Human (GRCh38)
Location 7:122218707-122218729
Sequence TGGGACCCACAAAATTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031475719_1031475723 0 Left 1031475719 7:122218707-122218729 CCCAGATAATTTTGTGGGTCCCA No data
Right 1031475723 7:122218730-122218752 TAGTCCTGAATTGCCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031475719 Original CRISPR TGGGACCCACAAAATTATCT GGG (reversed) Intergenic
No off target data available for this crispr