ID: 1031476394

View in Genome Browser
Species Human (GRCh38)
Location 7:122227829-122227851
Sequence CTGTAGTCCCATATTTAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031476394_1031476403 26 Left 1031476394 7:122227829-122227851 CCCTCCTAAATATGGGACTACAG No data
Right 1031476403 7:122227878-122227900 TCTGTATTTTTAGTAGAGATGGG 0: 1239
1: 91025
2: 241887
3: 157057
4: 80156
1031476394_1031476402 25 Left 1031476394 7:122227829-122227851 CCCTCCTAAATATGGGACTACAG No data
Right 1031476402 7:122227877-122227899 TTCTGTATTTTTAGTAGAGATGG 0: 2626
1: 198519
2: 142530
3: 68052
4: 38507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031476394 Original CRISPR CTGTAGTCCCATATTTAGGA GGG (reversed) Intergenic
No off target data available for this crispr