ID: 1031483123

View in Genome Browser
Species Human (GRCh38)
Location 7:122301765-122301787
Sequence ACAATTATGAAAAATTTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 513}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031483123_1031483127 19 Left 1031483123 7:122301765-122301787 CCCTCCAAATTTTTCATAATTGT 0: 1
1: 0
2: 4
3: 33
4: 513
Right 1031483127 7:122301807-122301829 AATACACAAAACCATTTAGCAGG 0: 1
1: 0
2: 3
3: 195
4: 2199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031483123 Original CRISPR ACAATTATGAAAAATTTGGA GGG (reversed) Exonic
900978535 1:6032899-6032921 ACAAAAATGAAAAATATGGGGGG + Intronic
901278601 1:8013363-8013385 ACAAATATGAAAAATTTTTTAGG - Exonic
901419347 1:9139910-9139932 AAAAATATGAAAAATTAGCATGG + Intergenic
904790356 1:33015729-33015751 AAAAATATGAAAAATTTAGCTGG + Intronic
905742749 1:40387147-40387169 AGAATTATGAAAAATAAGGCCGG - Intronic
906972699 1:50533662-50533684 ACAATGATGAAAAGTTTCTAAGG - Intronic
907697883 1:56752347-56752369 ACAATTATAAAACAGTTAGATGG - Intronic
907718220 1:56947633-56947655 ATAATTAAGAAAAATATGGCCGG + Intronic
907900186 1:58734160-58734182 GCCAAGATGAAAAATTTGGATGG + Intergenic
908023618 1:59925037-59925059 AAAATTATGAAGAATTAAGAGGG + Intronic
909077377 1:71067033-71067055 ACAACTATGAAAATTTTATAAGG + Intronic
909266946 1:73571825-73571847 ATAATTAAGAAATATTTGGTAGG - Intergenic
909296662 1:73957792-73957814 AGAATTATCAAGAAATTGGAAGG - Intergenic
911289680 1:96042297-96042319 ACAATTAGGCAAAATTGAGAAGG - Intergenic
911857400 1:102897119-102897141 AAACTTATGAAATATTTGGTAGG + Intronic
911964842 1:104353549-104353571 AAAATAAGAAAAAATTTGGACGG - Intergenic
912082582 1:105955354-105955376 ACATTTATTTAAAATGTGGAAGG + Intergenic
912163782 1:107018363-107018385 AGAATCATGAAAGATTTGTAAGG - Intergenic
912253195 1:108032053-108032075 ACATTTATGAAAAATTAGGAAGG - Intergenic
913307419 1:117445821-117445843 ACAAATATGAAAATTTGGGCAGG - Intronic
915096704 1:153467999-153468021 ACAATTATGAAAAAGATGGGAGG - Intergenic
915499659 1:156306657-156306679 AAAATTATGAAAAATTAGCCAGG + Intergenic
916174683 1:162027921-162027943 AAAATAATGAAGAGTTTGGAAGG - Intergenic
916339460 1:163713015-163713037 AAAATTACAAAAAATTAGGAGGG - Intergenic
916844030 1:168630164-168630186 AAAATTATGATAAATGTGGGTGG + Intergenic
918743970 1:188174617-188174639 GAAATTATGAAAAAATAGGAGGG + Intergenic
918820074 1:189242064-189242086 AAAACGATGAAAAATTTGGAGGG + Intergenic
919051892 1:192521896-192521918 ACATTTATGCCAAAATTGGAAGG + Intergenic
919933965 1:202239287-202239309 TAAATTCTGAAGAATTTGGAAGG + Intronic
920789870 1:209079743-209079765 ACAAATATGAAAAATAAGGGGGG - Intergenic
921415197 1:214878054-214878076 TCTATTATGAAAACTTAGGATGG + Intergenic
922385305 1:225075443-225075465 ATAATTTTTAAGAATTTGGAGGG - Intronic
1063770416 10:9191917-9191939 AAAATTCTCAAACATTTGGAAGG + Intergenic
1065106542 10:22393703-22393725 ACAATAATAAAATATTTGGATGG - Intronic
1065218253 10:23471488-23471510 CCAAATATCAAAATTTTGGAGGG + Intergenic
1065392048 10:25192711-25192733 ACAATTATTCAAATTTTTGAGGG + Intronic
1065777932 10:29139549-29139571 CCAATTAAGTTAAATTTGGAGGG + Intergenic
1066278699 10:33893228-33893250 ACATTTATGAAAAATTTAAATGG + Intergenic
1067457781 10:46434551-46434573 CCAATTATAACAAAGTTGGAGGG - Intergenic
1067629418 10:47950076-47950098 CCAATTATAACAAAGTTGGAGGG + Intergenic
1068140027 10:52994066-52994088 ACAATTATGAATAATTTAATTGG - Intergenic
1068259944 10:54566763-54566785 ACAATTTTCAAAACTTGGGAGGG - Intronic
1068827687 10:61457344-61457366 ACAATTTTAACAAATTTGGGTGG - Intergenic
1069545230 10:69322949-69322971 AAAATTGTGAAAAATCTGGCTGG + Intronic
1070262246 10:74869098-74869120 ACATTAAAGAAAAATTTTGAAGG + Intronic
1070651201 10:78237883-78237905 ACAATTATAAAATATATGTAAGG - Intergenic
1071228421 10:83558789-83558811 ACAATGTTAAAAAATTGGGATGG - Intergenic
1071320619 10:84452841-84452863 AAAATTAGGAAACATTTGGTGGG - Intronic
1071702015 10:87949183-87949205 ACAAATATTAAAAAGTTGGGAGG - Intronic
1072119540 10:92394410-92394432 AAAATTATCAAAAATTTGGCTGG + Intergenic
1072469584 10:95699812-95699834 ACATTTTTGAAGAAATTGGAAGG + Intergenic
1074453172 10:113575818-113575840 AATTTGATGAAAAATTTGGAGGG + Intronic
1074988617 10:118681296-118681318 ATGCTTATGAAAAATTTGGAGGG - Exonic
1075604559 10:123795064-123795086 ACAATTAAAAATAATTTGGCAGG - Intronic
1077716510 11:4586678-4586700 ACAATGAATACAAATTTGGAAGG + Intergenic
1078391971 11:10942899-10942921 AAAATGGTGAAAGATTTGGAAGG - Intergenic
1078804068 11:14679237-14679259 ATATCTATGAAAAATTTGGCTGG + Intronic
1079210222 11:18454735-18454757 ACAATTAGGTAAAATGTGGTGGG + Intergenic
1079442478 11:20529062-20529084 CCAATTATAAAAAAGATGGATGG - Intergenic
1079635926 11:22740227-22740249 ACAATTTTAAAATATTTGGGTGG - Intronic
1080140305 11:28910428-28910450 AAAAAAATGAAGAATTTGGAGGG - Intergenic
1080360783 11:31510391-31510413 ACAATTATAAAAACTTTTGCAGG - Intronic
1080544464 11:33302199-33302221 GCAGTTAGGAAAAATTGGGAAGG - Intronic
1081173341 11:39894586-39894608 TCAATTAAGATAAATTGGGATGG - Intergenic
1081269135 11:41063017-41063039 GAAATTATCACAAATTTGGATGG - Intronic
1083327957 11:61883024-61883046 ACAATTTTTAAAAAATTGGCTGG - Intronic
1083459717 11:62802908-62802930 AGAAATATGAAAATTTTGGTTGG - Intronic
1083461070 11:62812375-62812397 AGAATTATAAAAGATATGGAGGG - Intronic
1085872667 11:80368888-80368910 ACAATGAAGAAAATGTTGGAAGG + Intergenic
1085960884 11:81460289-81460311 AAAATTATGAAACCTTTGGTTGG - Intergenic
1086768210 11:90726619-90726641 TCAATTATGAAAAAGTTTGAAGG + Intergenic
1086941920 11:92807274-92807296 TGAATTAAAAAAAATTTGGAAGG - Intronic
1087443477 11:98216535-98216557 ACATTGATGAAAAAATTTGAAGG - Intergenic
1087469958 11:98560630-98560652 ACAATTTTGACAGATTTTGATGG + Intergenic
1087852038 11:103042920-103042942 ATAATTATGTATAATTTGTAGGG - Intergenic
1088354020 11:108922659-108922681 ACAATTCTGATAATTTTAGAGGG - Intronic
1090526013 11:127537580-127537602 CCAATATTGAAAAATCTGGATGG + Intergenic
1090945141 11:131422825-131422847 ACAACTATTTAAAATTTAGAAGG - Intronic
1090992205 11:131828097-131828119 ACAAATAAGGAAAATTTGGCAGG - Intronic
1091712526 12:2752193-2752215 TAAGTTAGGAAAAATTTGGAAGG - Intergenic
1091733886 12:2903264-2903286 TCTATTTTGAAAAATTTGGCCGG + Intronic
1092658529 12:10714060-10714082 ACAATTTTTTAAAAATTGGATGG + Intronic
1094180636 12:27589195-27589217 ACAATAAAGAACAATTTTGAAGG - Intronic
1094252711 12:28383414-28383436 AAATTAAGGAAAAATTTGGAAGG + Intronic
1094616078 12:32037559-32037581 AAAACTATGAAAAATTAGGCCGG - Intergenic
1095278171 12:40315739-40315761 ACGATTTTGAAAACTTTGGATGG + Intronic
1095552329 12:43457885-43457907 AAAATAATGAAAGATTTGAATGG - Intronic
1095692134 12:45101781-45101803 TCAAATATAAAAATTTTGGAAGG + Intergenic
1096880436 12:54664164-54664186 ACATGTATGAATAATTTTGAAGG + Intergenic
1097659705 12:62415851-62415873 ATCATTATGAAAAATGTGGCAGG + Intronic
1097927819 12:65149756-65149778 ATATGTATCAAAAATTTGGAGGG - Intergenic
1098368868 12:69736682-69736704 AAAAATGTGAAAGATTTGGATGG - Intergenic
1099057130 12:77857084-77857106 ATATTTCTGATAAATTTGGAGGG + Intronic
1100017664 12:90031005-90031027 ACATTTGTGTAATATTTGGAAGG + Intergenic
1100904488 12:99282063-99282085 GCAATTAAGAAAAATATAGAAGG + Intronic
1101160842 12:101973915-101973937 ACAATTTAGAAACATTTTGAAGG + Intronic
1102401067 12:112630183-112630205 ATATTTATGAAATAATTGGATGG - Intronic
1102918403 12:116773120-116773142 AAAATTATGAAAAATTGGCCGGG - Intronic
1103050796 12:117777870-117777892 AAAAATATGAAAAATTAGCAGGG + Intronic
1103885872 12:124199701-124199723 ACAAATAATAAGAATTTGGAAGG + Intronic
1103996832 12:124835568-124835590 AAATTTATGAAAAATTTCAAGGG - Intronic
1104512466 12:129392926-129392948 TCAATTATGATAAACTTGGAGGG + Intronic
1104574336 12:129953093-129953115 ACAATTTTGGAAATTTTGCAGGG - Intergenic
1106108361 13:26755186-26755208 ATAATTATGACAAATTTTAAAGG + Exonic
1106631663 13:31480480-31480502 AGAAGTTGGAAAAATTTGGAGGG - Intergenic
1107747790 13:43530332-43530354 ACAAGTAGGAAATAATTGGATGG - Intronic
1108420371 13:50242898-50242920 ATATTTAGGAAAATTTTGGATGG - Intronic
1109732489 13:66433273-66433295 AAAATTTTGAAAAATTTCAAAGG - Intronic
1110223369 13:73095410-73095432 TCAAACATGAAAAAATTGGAAGG - Intergenic
1110355749 13:74565035-74565057 ACAATCAGGAAAACATTGGATGG - Intergenic
1111378607 13:87414697-87414719 TCAATTATAAAAAATGTGGCCGG - Intergenic
1111473744 13:88719868-88719890 CCAAATATGAAATATTTGCATGG - Intergenic
1111661481 13:91217731-91217753 ACAATTCTGAAGAATCTAGATGG - Intergenic
1111702909 13:91713283-91713305 ATATTTATGAAAAAATTGAAAGG + Intronic
1111956947 13:94769716-94769738 ACAATTATGAATTATTTTCATGG - Intergenic
1112345860 13:98588847-98588869 ATACTTATGAAAGATGTGGATGG + Intergenic
1112851626 13:103712919-103712941 ATATTTATGAAAAAATAGGAAGG - Intergenic
1112887518 13:104192789-104192811 AGAAGTTGGAAAAATTTGGAGGG + Intergenic
1113069463 13:106406467-106406489 ACAATGATGAAAAAGATGGATGG + Intergenic
1115562457 14:34595431-34595453 ACAATTAAGAAAACTGTGGCCGG - Intronic
1115871406 14:37807716-37807738 ACAGTTTGGAAAAATATGGAAGG + Intronic
1115918068 14:38339795-38339817 AAAATGATGAAACATTAGGAGGG + Intergenic
1115983682 14:39081673-39081695 ACAAATATGGAAAAGTGGGAAGG + Intronic
1117169019 14:53071404-53071426 ACATTTATGAAATGTATGGAAGG - Intronic
1117696732 14:58372196-58372218 AAAATTATGACAAATATGGCAGG - Exonic
1118190749 14:63577920-63577942 AAAATTACAAAAAATTTGGCCGG - Intergenic
1118207945 14:63740730-63740752 ACACATATGTATAATTTGGAGGG + Intergenic
1118263793 14:64273830-64273852 ACAATTCTGAAAAATAGAGAAGG - Intronic
1118844588 14:69537470-69537492 ATAATTAAGAAAACTTGGGAAGG + Intergenic
1120879820 14:89406433-89406455 ATAATTTTTAAAAAGTTGGAAGG + Intronic
1121541736 14:94732863-94732885 AGCATGAAGAAAAATTTGGAGGG - Intergenic
1121976335 14:98407512-98407534 AAAATCATGAAAAAATGGGAAGG + Intergenic
1123206957 14:106723168-106723190 ACTAATATGAAGAATTTGCAAGG - Intergenic
1123211975 14:106770172-106770194 ACTAATATGAAGAATTTGCAAGG - Intergenic
1124164947 15:27318145-27318167 ACACTTATGAGCACTTTGGAAGG + Intronic
1126498714 15:49321068-49321090 ACAATTAAAAATAATTTGAATGG + Intronic
1127304741 15:57694179-57694201 ACTATTATGAATGATGTGGAAGG - Intronic
1128177944 15:65573248-65573270 ACAAATATGACAAATTTAAAAGG + Intronic
1129125924 15:73441329-73441351 AGGAATATGAAAAATTTGCATGG - Intergenic
1130186717 15:81690418-81690440 AAAATCATCAGAAATTTGGATGG - Intergenic
1130788805 15:87129679-87129701 ACAATTATCAAAACTTTTGTTGG - Intergenic
1131034503 15:89212654-89212676 ACATGTATGAAAAGATTGGAAGG + Intronic
1132378104 15:101345466-101345488 ATAATTATCAAAACTCTGGAGGG + Intronic
1132388516 15:101420520-101420542 AAAATTTTGAAAAATTTAGCCGG - Intronic
1133320149 16:4908698-4908720 AAAAATATGAAAAATTTGCCAGG - Intronic
1133571373 16:7043630-7043652 ACAATTATGAATCACTTAGAAGG - Intronic
1134271673 16:12738289-12738311 AAAATTTTTAAAAATTAGGAAGG + Intronic
1135241365 16:20809356-20809378 ACAACTACAGAAAATTTGGATGG - Intronic
1135633424 16:24054132-24054154 AAAATTTTTAAAAATTTGGCTGG - Intronic
1137739813 16:50757830-50757852 ACAATCATGAAAAACTAGGCCGG - Intronic
1137747679 16:50835048-50835070 AGAATGTTGAAAAATTTGGTGGG + Intergenic
1137968910 16:52964323-52964345 ACTTTTATTAACAATTTGGATGG + Intergenic
1137969238 16:52967413-52967435 ACTATAATGGAAAATTTTGATGG - Intergenic
1138040659 16:53661328-53661350 ACAATACTTAAAAATTTTGAAGG + Intronic
1138980893 16:62266800-62266822 ACTATTCTGAAAAATTGAGAAGG + Intergenic
1139158152 16:64469302-64469324 ACAATCATGAAAAGATTGAAAGG + Intergenic
1140980889 16:80108335-80108357 AGATTTATGAAAAAGTTGCAAGG - Intergenic
1141242879 16:82279169-82279191 ACAATTATGAATATTGAGGAAGG - Intergenic
1141808331 16:86357121-86357143 GCAATTATGAAAACTTTTAAAGG - Intergenic
1144009698 17:11134954-11134976 CCATTTATGAAAAGTTGGGAAGG + Intergenic
1144281665 17:13733006-13733028 AGAGGTATGAACAATTTGGAGGG + Intergenic
1145965599 17:28914509-28914531 ACAAATATGAAAAATTAGCCGGG + Intronic
1148249221 17:46060583-46060605 ACTAGTATGAAAAAGTTGGTTGG + Intronic
1151034416 17:70781669-70781691 ACAAATGTGAAAACTTTGTATGG + Intergenic
1151124483 17:71830165-71830187 ACAATTATCAAAAATTTTACAGG - Intergenic
1153464643 18:5376002-5376024 ATAATTATGATAATTTTGCATGG - Intergenic
1153770961 18:8416231-8416253 AGGATTCTGTAAAATTTGGAGGG - Intergenic
1155846980 18:30720370-30720392 TCAATTATGAAAAATATGGTTGG + Intergenic
1155902606 18:31409835-31409857 ATAATTTTGAAAAATTTAAAAGG - Intronic
1156201732 18:34840774-34840796 AAAACTATGAGAAATATGGAGGG - Intronic
1156579942 18:38363299-38363321 ACCATTATTAACAATTTGGGGGG - Intergenic
1156585183 18:38424063-38424085 GCAATTAGGTAAAATTTGTAAGG - Intergenic
1157213408 18:45762816-45762838 AAAAATATGAAAAATTAGCAGGG - Intergenic
1158845902 18:61442669-61442691 ACCATTTTGTAAAATTTGTAAGG + Intronic
1159326275 18:66923629-66923651 GCAGCTATGAAAAACTTGGAGGG + Intergenic
1159326478 18:66926201-66926223 ACAGCTATGAAAAACTTGGAGGG + Intergenic
1160063979 18:75557797-75557819 ACATTTGTTAAAAGTTTGGAAGG - Intergenic
1161902467 19:7129619-7129641 AAAATTATTAAGAATTTGGCCGG - Intronic
1162318409 19:9955702-9955724 AAAAATATGAAAAATTAGCAGGG - Intergenic
1162521485 19:11182680-11182702 AAAAATATAAAAAATTAGGAAGG + Intronic
1164221871 19:23202129-23202151 AAAAATATAAAAAATTTGGCCGG - Intergenic
1164647203 19:29867793-29867815 AAAAATATGAAAAATTAGGTAGG - Intergenic
1165444143 19:35847650-35847672 ACAATGCTGTAAAATTTGGCTGG - Intronic
1166600138 19:44086506-44086528 ACAAATGTGAAGAATGTGGAAGG + Exonic
1166605063 19:44134650-44134672 ATAATTATTAAAAGTTTGGTAGG + Exonic
1166607384 19:44156795-44156817 ACAATTGTGAGGAATGTGGAAGG + Exonic
1166612987 19:44216076-44216098 ACTATAATGACAAATTTTGAGGG - Intronic
1167662084 19:50801448-50801470 ACAACTATGGAAAACTTGGCAGG - Intronic
1168200984 19:54816065-54816087 ACAATCATGAAAAATTCTAATGG + Intronic
925248307 2:2404931-2404953 AAAATGATAAAAAATATGGATGG + Intergenic
925877346 2:8324094-8324116 ATAAATCTGAAAAAATTGGAAGG - Intergenic
926854344 2:17236564-17236586 AAAATAATAATAAATTTGGAAGG + Intergenic
926931529 2:18046199-18046221 AGAATTATGCAAAATTTGGAGGG + Intronic
927121172 2:19964796-19964818 ACCATAATGAAAACTTTGGCTGG - Intronic
927121406 2:19967304-19967326 GCAAATATAAAAAATATGGATGG - Intronic
927736692 2:25530061-25530083 ATAATTATGAAAAACAGGGATGG + Intronic
928050826 2:27993408-27993430 AAAATTTAGAGAAATTTGGAGGG + Intronic
928222348 2:29414772-29414794 ACAATTAGGATAAATTAGCAAGG + Intronic
928378256 2:30796797-30796819 AAAACTATGAAAGATTTGGCAGG + Intronic
928749779 2:34458050-34458072 ACAATTATGGAGAAGTTGAAGGG - Intergenic
928799580 2:35070974-35070996 TGAATTAGGAAAAATTTGAAAGG + Intergenic
928966336 2:36979092-36979114 AAAAATATGAAAAATTAGCAGGG + Intronic
929909332 2:46075586-46075608 AAAAATATGAAAAATTAGGCAGG + Intronic
929988383 2:46761055-46761077 ACTATAATTAATAATTTGGATGG + Exonic
930154519 2:48092542-48092564 TCAAGTGAGAAAAATTTGGAGGG + Intergenic
930441000 2:51405722-51405744 AAAAATATGAAAAATTTGCCAGG - Intergenic
930982438 2:57543654-57543676 AGAATTATAAACAATTTAGATGG - Intergenic
932341842 2:70967562-70967584 ACAATTATAAATAAATTGTATGG - Intronic
932999119 2:76899655-76899677 AAAATTATTAAAACTATGGATGG + Intronic
934508779 2:94918897-94918919 ACATTTAAGAAAAATTAGGTTGG - Intergenic
936977127 2:118231586-118231608 ACAATTATAAAGATTTTGGGGGG + Intergenic
937757111 2:125553181-125553203 TCTATAATGAAAAATTTGCAAGG - Intergenic
938129298 2:128697348-128697370 ACAATAATGAAAAAAATAGATGG + Intergenic
938601909 2:132850994-132851016 GCTTTTCTGAAAAATTTGGAAGG - Intronic
938882862 2:135609540-135609562 ATTTTTATGAAACATTTGGAAGG + Intronic
940120786 2:150262788-150262810 CAAATTATTAAAAATTTGCATGG + Intergenic
940148756 2:150576396-150576418 ATAATCATCCAAAATTTGGATGG + Intergenic
940168695 2:150803419-150803441 ACAATAATAAAAAATTTTCATGG - Intergenic
940736691 2:157461537-157461559 AGAATGATTAAAAGTTTGGAAGG - Intronic
940753569 2:157656106-157656128 AAAATTATTAATATTTTGGAAGG + Intergenic
940952894 2:159696385-159696407 ACAGTTAAGAAAAATATAGAAGG - Intergenic
941099193 2:161278335-161278357 ACAAAAATAAAAAATTTGCAAGG + Intergenic
941459948 2:165758383-165758405 ACATTTATGAATAATTTTAAAGG - Intronic
941658197 2:168167113-168167135 AAAATTATGAAAAGCTTTGAAGG + Intronic
941974789 2:171391686-171391708 ACAAGTATGAAAAAGAGGGAAGG + Intronic
942237762 2:173928836-173928858 TCAAATATGTAAAAATTGGAGGG - Intronic
942302653 2:174576611-174576633 AAAATTGTGAAAGATTTTGATGG + Intronic
942973893 2:181990970-181990992 ACAATAAAGAAAGATTTGCAGGG - Intronic
943214076 2:185007620-185007642 ACAAAAAAGAAAATTTTGGAGGG + Intergenic
943456684 2:188117068-188117090 TACATTATGAAAAATGTGGAAGG - Intergenic
943458553 2:188140035-188140057 AAAAAAATGAAAGATTTGGAAGG - Intergenic
943466163 2:188231472-188231494 AAAACCATGAAACATTTGGATGG + Intergenic
943813030 2:192213185-192213207 ACATTTAGGAGAAAATTGGAGGG - Intergenic
945141777 2:206694232-206694254 ATAATTTTAAAAAATTTGAAAGG + Intronic
945385970 2:209201492-209201514 AATATTATTAAAAATTTGAATGG - Intergenic
945939132 2:215930859-215930881 ATAATTATTTAAAATTTGGTAGG + Intergenic
947295002 2:228621219-228621241 ACAAATAAGAAAATTATGGATGG + Intergenic
947594036 2:231399782-231399804 TTATTTATGAAGAATTTGGAGGG + Exonic
948283454 2:236766519-236766541 ACAATTTTCAAAAATTTTGGTGG - Intergenic
1169589755 20:7127412-7127434 ACAATTTTGAAAATTTTGAGGGG - Intergenic
1169589913 20:7129173-7129195 ATATTTATGAAATATATGGAAGG - Intergenic
1169683192 20:8240256-8240278 AATATCATGAAAATTTTGGAAGG - Intronic
1169797835 20:9484055-9484077 AAAATTAGGAAAAATTTCCAAGG + Intergenic
1169969234 20:11251119-11251141 ATTATTATGAAAATCTTGGAAGG - Intergenic
1172326884 20:34042947-34042969 AAAATTATCCAAAATTTGGAAGG - Intronic
1173033531 20:39385766-39385788 ACAATTTTGAAGAATAAGGATGG - Intergenic
1174958236 20:55124867-55124889 ACAAACATGTAAGATTTGGAAGG - Intergenic
1175589753 20:60179662-60179684 ACAATTAAAAAAAAATTGGAAGG - Intergenic
1175644028 20:60656284-60656306 GTAATTATCAAATATTTGGAGGG + Intergenic
1176805970 21:13483440-13483462 ACATTTAAGAAAAATTAGGTCGG - Intergenic
1177423612 21:20894645-20894667 ACAACTTTTAAAAACTTGGAAGG + Intergenic
1177467244 21:21501981-21502003 AGACTTTTTAAAAATTTGGAAGG - Intronic
1177711881 21:24786910-24786932 ATAATTATGCAAATTTTGGGGGG - Intergenic
1177859985 21:26441020-26441042 ACAATTATTAAACTTTTGGCTGG - Intergenic
1178856612 21:36255421-36255443 AAAATTATGCAAATTTTGGCCGG - Intronic
1179520177 21:41938370-41938392 ACAATAATTAAAAATATGGAAGG - Intronic
1179877379 21:44276620-44276642 ACAATTTTGAAAAATAAGAATGG + Intergenic
1181414575 22:22750119-22750141 TCAATTGTGAAAAATTTATAAGG + Intronic
1181553593 22:23654863-23654885 ACATTTTTGAAAAATTTTGTAGG + Intergenic
949212534 3:1522581-1522603 AGAATAATGAAAAATTTGCAGGG + Intergenic
949221071 3:1634518-1634540 ACAATTATGATAAATGTTGTGGG - Intergenic
949628717 3:5898263-5898285 CCAACTGTGAAAAATATGGAGGG + Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
951079397 3:18434022-18434044 ACATTTATGAAAAATTTTGATGG + Intronic
951385690 3:22039471-22039493 AGAATGATGAAAAATTTGGCTGG - Intronic
951487939 3:23235072-23235094 GCAATTATGAACAAGATGGAAGG + Intronic
951790066 3:26471037-26471059 ACAATTATGCAAAATATGTAGGG - Intergenic
952066080 3:29572807-29572829 ACAATTCTGAAAAATAGGGGAGG - Intronic
953892299 3:46760982-46761004 ACAATTAAAAAAAATTTGACCGG + Intronic
954051265 3:47979983-47980005 ATAATAATGAAAAATTAGGCAGG - Intronic
954728532 3:52637470-52637492 ACAAATATAAAAAATTTGCTGGG + Intronic
955313396 3:57913654-57913676 ACTATAATGAAGAATTTGTAAGG + Intronic
955914966 3:63898730-63898752 GCAATTTTAACAAATTTGGAGGG - Intronic
957432610 3:80131484-80131506 ACAAGTATGTAAAATTTCAAAGG - Intergenic
957986827 3:87582542-87582564 ACAACCATGAAAAATTAGGCTGG - Intergenic
958602995 3:96323197-96323219 ACAATTATGAAAAAGATAAAGGG - Intergenic
958909941 3:99982765-99982787 ACATTTTTGAAAAATGAGGAAGG - Intronic
959085414 3:101847368-101847390 AAAGTTATCAAAAAGTTGGAGGG + Intronic
959140445 3:102480244-102480266 ACAATTTTAAAAACTTTGGTAGG + Intergenic
959196359 3:103187891-103187913 ACATTTATGCAAAATATTGAAGG + Intergenic
959927828 3:111944610-111944632 ACAATTATGTGTTATTTGGAAGG + Intronic
959945132 3:112118144-112118166 AAAATAATGAAAAATTTTAATGG + Exonic
960210528 3:114959526-114959548 AAAATGATGACAAATTTGCAAGG + Intronic
960426860 3:117519358-117519380 ACAATTATAAAATTGTTGGATGG + Intergenic
960440630 3:117683072-117683094 ACATTAATGGAAAATTTTGAGGG + Intergenic
960558951 3:119061064-119061086 ACAATAAGGAAAAAATTAGATGG + Intronic
960785337 3:121367473-121367495 CTGATTATGAAAACTTTGGATGG - Intronic
961575655 3:127833946-127833968 AAAATTACTGAAAATTTGGATGG + Intergenic
961616623 3:128187891-128187913 AGAAGTATGAAGGATTTGGAGGG + Intronic
962030124 3:131590748-131590770 ACAGTTATGGAAAATTTGGTGGG + Intronic
962139925 3:132779094-132779116 ACAATTATTATAGATTTGGATGG - Intergenic
962247819 3:133811741-133811763 AAAATTATGAAAAATTAGCAGGG - Intronic
962508174 3:136069953-136069975 ACAATTATGATAAAATCTGATGG + Intronic
963327958 3:143882644-143882666 AAATTTATGCAAGATTTGGAGGG + Intergenic
963969454 3:151413613-151413635 ACACTTTTAAAAAATTTGCATGG - Intronic
964414964 3:156437837-156437859 AGGATGAAGAAAAATTTGGAAGG - Intronic
964695283 3:159500843-159500865 AGAATTATGAAAAATATGGTTGG - Intronic
964767703 3:160194762-160194784 GCAAATTTGAACAATTTGGATGG - Intergenic
964992394 3:162829482-162829504 GCAATTATGAAGATTTTAGAGGG - Intergenic
965179050 3:165377414-165377436 ACTATTTTGAAAAAATTGGTGGG + Intergenic
965723521 3:171688021-171688043 ACACTTATTAAAAAATTTGATGG - Intronic
965798329 3:172465570-172465592 CCAATTATGAGAACTCTGGAAGG - Intergenic
966111420 3:176406711-176406733 ATAATTATGTAAAATGTGAATGG - Intergenic
967390868 3:188952697-188952719 AAAATCATTAAAAATTTGGGTGG + Intronic
967773071 3:193356202-193356224 ACTATAATGAAAAATATGGCAGG - Intronic
968420739 4:482459-482481 AAAATTAAGAAAAATTGGGCCGG - Intronic
968475890 4:808106-808128 AAAATTATGAAAAATTCGCCAGG + Intronic
969962570 4:10960269-10960291 AGTATTATGGAAACTTTGGAAGG - Intergenic
970646992 4:18133759-18133781 ACAATTATTGAAAGTTTGGTTGG + Intergenic
971015274 4:22482715-22482737 ACAATTACCAAAAATTTGCAAGG + Intronic
971718421 4:30212192-30212214 AAAATTTTGAAAATTTAGGAGGG + Intergenic
971767719 4:30854698-30854720 ACACTTATAAAAAATATGCATGG - Intronic
971888197 4:32481068-32481090 CCTATTATGAGAATTTTGGAAGG + Intergenic
971966858 4:33570375-33570397 AGAATTACTAAAAATTTTGAGGG + Intergenic
972183025 4:36492757-36492779 ATTATTATGAGTAATTTGGATGG - Intergenic
972443213 4:39117138-39117160 AAAATTTTGAAAAATTAGCAAGG + Intronic
972674666 4:41248908-41248930 ACAATAATGAAGATTTGGGATGG - Intergenic
972868362 4:43262807-43262829 ACTATTCTGAAAAATTAAGAAGG - Intergenic
973032130 4:45358590-45358612 AGAAGTTTGAAAAGTTTGGAGGG + Intergenic
973212926 4:47636910-47636932 AGAATTTGGAAAAGTTTGGAGGG + Intronic
973536252 4:51885312-51885334 ACAATTAAGAAATAATTAGAAGG + Intronic
974129777 4:57739744-57739766 ACAATTATTAAAAATATTGCTGG + Intergenic
974167751 4:58225601-58225623 ACATGTATGAATTATTTGGAGGG - Intergenic
974563992 4:63560008-63560030 ACAATTTTGGAAAAGTTAGATGG - Intergenic
974692249 4:65311626-65311648 ACAAGTATGATGAATCTGGATGG - Intergenic
974757000 4:66222661-66222683 AATATTCTGAAAAATTTGTAAGG + Intergenic
975060342 4:69989260-69989282 ACAATTGTGAAACCTTTGCATGG + Intergenic
975133862 4:70855121-70855143 ACACTTATGGACAATTTTGAGGG + Intergenic
975317320 4:72969635-72969657 ACAGTTAGGAAGAATTGGGATGG - Intergenic
975624114 4:76325458-76325480 AAAATTTTGAAAAGTTTGTACGG + Intronic
976238416 4:82926770-82926792 ACAATTTTGAAAATTTTGTTAGG + Exonic
976251197 4:83053538-83053560 ACAATTTTAAAAAATTAAGATGG + Intronic
976601367 4:86940698-86940720 ACAACTATAAAAGATTAGGAAGG - Intronic
976894306 4:90089880-90089902 AAAATTAGTAAAAAATTGGAAGG + Intergenic
977668573 4:99669681-99669703 ACAATGATGGAAAATTGTGATGG - Intergenic
977812091 4:101368049-101368071 ACAAAGATGAAAAATGTGGCTGG + Intergenic
977954177 4:103008275-103008297 AAAATAGTGAAAAATTTTGATGG + Intronic
978024679 4:103858332-103858354 AAAATTTTGAAAAACTTGAATGG - Intergenic
978990239 4:115071923-115071945 ATAAATATGAGAAATTTGAATGG - Intronic
979098430 4:116582197-116582219 ACAATTATGAAATACTTTAAAGG - Intergenic
979120174 4:116888990-116889012 AAAATTATTAAAAATTAAGAAGG + Intergenic
979792963 4:124809254-124809276 ACAATTATGTAAAATTTATCAGG - Intergenic
979942376 4:126778019-126778041 TCAAATATGAAAAATTAGCATGG + Intergenic
980142760 4:128940408-128940430 ACAATTATGTAGAAGTTAGAAGG - Intronic
981233152 4:142382825-142382847 AAAATTATTTAAAATTTGGGAGG - Intronic
981236160 4:142418275-142418297 ATAATTATGAAACATTTCAAGGG + Intronic
981440944 4:144780957-144780979 AGAATTATGGAAAAGTTGTAAGG - Intergenic
981549098 4:145924787-145924809 AGAAGTAGGAAAAATATGGAAGG - Intronic
982265197 4:153532208-153532230 ATAATTATGGGAAATGTGGATGG + Intronic
982294296 4:153810869-153810891 ATAATTATGAAAAATTAAAATGG + Intergenic
982878322 4:160675880-160675902 ACAATAAAGAGAAATTGGGATGG + Intergenic
982993353 4:162308049-162308071 ACAAGTATGAAACATTTGCCTGG - Intergenic
983605087 4:169574247-169574269 AGAATTATGACAATATTGGAAGG + Intronic
983855259 4:172635521-172635543 TCAAATATGCAAAATTTGAAAGG - Intronic
984034337 4:174647245-174647267 AAAATTATGAAAAATTAGCCAGG + Intronic
984502652 4:180576054-180576076 ACAATGATAACAAATGTGGAAGG + Intergenic
984728870 4:183046935-183046957 ACAAATATAAAAAATTTAGCTGG + Intergenic
985003651 4:185511224-185511246 ACAAATATGTAAAATTTTTAAGG - Intronic
985081264 4:186266789-186266811 ACAAAGATGAAAAATTGGGGTGG + Intronic
986519322 5:8596751-8596773 CTAATTATGAAAAATTTGCATGG - Intergenic
986851456 5:11818130-11818152 ATAATCTTGAAAAATTAGGAAGG + Intronic
986935454 5:12878835-12878857 AAAATTATGAAAACTATGAATGG - Intergenic
986980478 5:13442651-13442673 CCAATTATGAAAAATCAGAATGG + Intergenic
988273781 5:29053873-29053895 CCAATTATCAAAACTTCGGAAGG + Intergenic
988434039 5:31152776-31152798 ACAAAAATAGAAAATTTGGAAGG - Intergenic
988702088 5:33685676-33685698 AGGATTATGTAAACTTTGGAGGG + Intronic
988801746 5:34702320-34702342 AAAAATATGAAAAATTAGGCTGG + Intronic
989109987 5:37897775-37897797 ACAATTTTGCAAAACTTGAATGG - Intergenic
989381267 5:40811569-40811591 TCTATTATGTAATATTTGGAAGG + Intergenic
989481126 5:41931402-41931424 GAAGTTAAGAAAAATTTGGAAGG + Intronic
990227505 5:53671744-53671766 ACAGCTGTGGAAAATTTGGATGG + Intronic
990393022 5:55347015-55347037 ACAATTTTGAAAACATTTGATGG - Exonic
990493978 5:56328256-56328278 AGAATTATGAAAAATTAATAAGG - Intergenic
990550169 5:56868031-56868053 ACAAGTATGTAAAAATCGGAAGG + Intronic
991280009 5:64902661-64902683 ACAACTTTGAAAAATGTGGGAGG - Intronic
991541080 5:67728847-67728869 ACAATTATGGAAAATTTCAGAGG + Intergenic
991581794 5:68163230-68163252 ACTATTATCAAAAATTTGATAGG - Intergenic
992746209 5:79823376-79823398 AAAATTCTAAAAAATTTGGGGGG - Intergenic
993023662 5:82622361-82622383 CCAACAATGAAATATTTGGATGG + Intergenic
993203848 5:84853018-84853040 ACATTTTTGTAAAATTTAGATGG + Intergenic
993272910 5:85818000-85818022 AAAATTATGAAATATTTGCGGGG + Intergenic
993567886 5:89497879-89497901 ACGCTTTTGAAAAATTTGGCAGG - Intergenic
994501610 5:100586095-100586117 ACTATTCAGAAAGATTTGGAGGG - Intronic
994973216 5:106770276-106770298 AAAAATATGAAAAATTAGAAGGG - Intergenic
994985139 5:106923543-106923565 ACAATAATGAAATATTTTGTTGG + Intergenic
995625086 5:114067619-114067641 ATAAATATAGAAAATTTGGAAGG + Intergenic
996191237 5:120544852-120544874 ACTCTTTTGAAAAATTTAGATGG + Intronic
996250466 5:121323323-121323345 ACAAATATGAATAATTTCTATGG - Intergenic
996258782 5:121440054-121440076 ACTATTCTGAAAAATTGAGAAGG - Intergenic
996883840 5:128332082-128332104 ATAAGTATGAAATATTTGAATGG + Intronic
997176430 5:131782741-131782763 ACCATTATGAATAACTTTGAGGG + Intronic
997792740 5:136776295-136776317 ACAATCATAAAACATTTTGATGG + Intergenic
997992871 5:138560707-138560729 AAAAATATAAAAAATTTGGTGGG - Intronic
998292023 5:140925279-140925301 CCAATAATGAAACATTTGAAAGG - Intronic
998640057 5:143999595-143999617 AGAATTAGGAAAAATATAGAAGG + Intergenic
998927624 5:147143466-147143488 ACAATGAAGAAAAATTTTAATGG - Intergenic
999657307 5:153823336-153823358 ACAGTTATGAAAAAGTTTTATGG - Intergenic
999733639 5:154495423-154495445 TCTAGTATGAAAGATTTGGAGGG - Intergenic
999884510 5:155906079-155906101 ATAATAATGAAAAAGTTTGAAGG - Intronic
999929444 5:156414743-156414765 ACAACAATTAAATATTTGGAAGG + Intronic
1000867343 5:166530518-166530540 ACATTTTTTAAAAACTTGGATGG + Intergenic
1002129040 5:177068242-177068264 AAAATTATGAGAAAAATGGAGGG - Intronic
1003317758 6:5027287-5027309 AAAATTATAAAAAATTAGGCAGG - Intergenic
1003614536 6:7642947-7642969 ACAATTCTGCAGAACTTGGATGG - Intergenic
1004206488 6:13596266-13596288 ACAATGAGGAAAAAATTTGAGGG + Intronic
1004747101 6:18521628-18521650 ACAATAATGTACATTTTGGATGG - Intergenic
1005264896 6:24101371-24101393 ACAATTAAGAAGAAATTGCAAGG - Intergenic
1005714592 6:28534782-28534804 ACAATTAGGAAAACTTTTGTAGG - Exonic
1005751684 6:28888817-28888839 ACAATTTTGAAATGTTTGAATGG - Intergenic
1008724505 6:54400572-54400594 ATAATTATAATAAATTTTGAGGG + Intergenic
1009460090 6:63902580-63902602 ATAATAATGAAAAGTTTGGGAGG + Intronic
1009534076 6:64858594-64858616 AAAATTATCTTAAATTTGGATGG - Intronic
1010051334 6:71507852-71507874 GGGATTATGAAAAATTTTGAGGG - Intergenic
1010336928 6:74696495-74696517 ATAATTTTAAAAAACTTGGATGG + Intergenic
1010548351 6:77187384-77187406 ACTATTATGAAAAATAAAGATGG + Intergenic
1010746722 6:79570995-79571017 GCAATTATGTAATTTTTGGAGGG - Intergenic
1011900121 6:92283879-92283901 ACAAATATGACAATTTTGAATGG - Intergenic
1011904994 6:92353741-92353763 ACAATTATGGAAACTGTTGATGG + Intergenic
1012023805 6:93962409-93962431 CCAATTATGGAAAATGGGGATGG + Intergenic
1012237030 6:96831044-96831066 ACATTTAAAATAAATTTGGAAGG - Intronic
1012316629 6:97789212-97789234 AGAAACATGAAAAATTTTGAGGG - Intergenic
1013341047 6:109216134-109216156 ACAATTATGAAACTCTTGGAAGG - Intergenic
1015332236 6:131994046-131994068 ACAATTTTGATAAATTTCGTCGG + Intergenic
1015762140 6:136675014-136675036 ACATTTATTTAATATTTGGATGG - Intronic
1016073121 6:139764387-139764409 AGAATAATGAAAGATATGGAGGG - Intergenic
1016094952 6:140024225-140024247 ACACTTTTCAAAAATATGGAGGG - Intergenic
1016112637 6:140244423-140244445 ACAATTCTGAGAATTTTGAAAGG - Intergenic
1016340328 6:143055043-143055065 ACAATTTTTAAATATTTGAATGG + Intergenic
1016453319 6:144206265-144206287 ACAATTCTGAAAAATTGAGGAGG - Intergenic
1017294373 6:152776920-152776942 ACATTTATGAAGAATTTGGAGGG + Intergenic
1017853512 6:158327774-158327796 TCAATTATAAAAAATCTGGGTGG - Intronic
1018425996 6:163681256-163681278 ACACTGATGTGAAATTTGGAAGG + Intergenic
1018637434 6:165875789-165875811 ACAATTATCAAACATCTGGTAGG - Intronic
1018995742 6:168709381-168709403 GCCATGATGTAAAATTTGGAAGG + Intergenic
1020237574 7:6368256-6368278 ACAATCATGAAAATATTGAAAGG - Intergenic
1021089377 7:16464840-16464862 ACAATTATCTAAATTTTGAATGG + Intronic
1022676166 7:32501275-32501297 ACAATAATGAAACATTTGGGAGG + Intronic
1022839521 7:34149779-34149801 ACATTAGTGAAAACTTTGGAGGG + Intronic
1022859451 7:34352222-34352244 ACAGTTAAGAGATATTTGGAGGG + Intergenic
1023165042 7:37335465-37335487 ATGCTTATGAAAAATATGGAAGG + Intronic
1023681638 7:42693596-42693618 CTAATTATTTAAAATTTGGAAGG - Intergenic
1024003799 7:45210657-45210679 ACATTTGAGAAAAATTTAGATGG - Intergenic
1024745857 7:52405130-52405152 ACATTTGAGAGAAATTTGGAGGG + Intergenic
1024915554 7:54494915-54494937 AAAATTTTGAAAAACTTGTATGG - Intergenic
1026124409 7:67566938-67566960 ACTATTATGAAAATTTAGGAAGG - Intergenic
1026130894 7:67620095-67620117 AAGATAATGAAGAATTTGGAAGG - Intergenic
1026384632 7:69833982-69834004 ACAATTTTGAAAAATTTCCAAGG + Intronic
1026875911 7:73879094-73879116 AAAAATATGAAAAATTAGGCGGG - Intergenic
1026998845 7:74637613-74637635 ACAAAAAAGAAAAATTTGGCCGG - Intergenic
1027956340 7:84883395-84883417 AAAATTATGAAAAATATAAAAGG - Intergenic
1028107150 7:86892141-86892163 CCAATAATGAAAAAATTGGGGGG + Intronic
1028131739 7:87183548-87183570 ACAATTATGAATACTGTGGATGG - Intronic
1028510320 7:91618172-91618194 ACAAATATGAAAAATCAGGTTGG - Intergenic
1028991132 7:97050208-97050230 TAAATTAGGAAAAATTTGTATGG + Intergenic
1029410213 7:100404764-100404786 ACAAATAAGGGAAATTTGGAGGG + Intronic
1030295282 7:107919362-107919384 TGAATTATGAAACTTTTGGAAGG + Exonic
1030595512 7:111533632-111533654 ACAATTAGCTACAATTTGGAAGG + Intronic
1030780051 7:113589421-113589443 AGGATTATGAAATATTTTGATGG - Intergenic
1030814615 7:114020564-114020586 ACAATTGTTAAAAATAGGGAGGG - Intronic
1030943733 7:115689951-115689973 ACAATGAATAAATATTTGGAAGG + Intergenic
1031143637 7:117973402-117973424 AAAATTATAAAAAATTTGCCAGG + Intergenic
1031483123 7:122301765-122301787 ACAATTATGAAAAATTTGGAGGG - Exonic
1031515596 7:122694455-122694477 ACAGTGATGAAAAATATGCATGG + Intronic
1031670983 7:124545025-124545047 AAAATGATGAAAAACTTGGCCGG - Intergenic
1031693847 7:124824206-124824228 AGAATAATGTTAAATTTGGAAGG - Intronic
1032301891 7:130695279-130695301 ACAAGTAAGAAAATTTGGGATGG - Intergenic
1032450380 7:132025368-132025390 AAAATTTTGAAAAATTTAAAAGG - Intergenic
1033877805 7:145843505-145843527 ACAATTAAAAAAAAATTAGATGG - Intergenic
1034017705 7:147605242-147605264 TCAATTATCAAAAATTCAGAGGG - Intronic
1034331102 7:150282876-150282898 AAAATTATGTAAAATGCGGAGGG - Intronic
1034666941 7:152826977-152826999 AAAATTATGTAAAATGCGGAGGG + Intronic
1034940609 7:155228020-155228042 AGGATTTTGAAAGATTTGGAGGG + Intergenic
1035130834 7:156651508-156651530 AGAATTATTAAAAATATGGCTGG - Intronic
1036904191 8:12693778-12693800 AAAATTACGAAAAATATTGAAGG - Intergenic
1036921581 8:12860738-12860760 ACAATGAGAAAAAAATTGGAGGG - Intergenic
1037045278 8:14293069-14293091 TCACTTTTGAAAAATTTGTAGGG - Intronic
1037285784 8:17298458-17298480 TCTAGTATGAAAGATTTGGAGGG - Exonic
1037377678 8:18249703-18249725 ACAAGAATGAGAAATGTGGATGG + Intergenic
1037436561 8:18869743-18869765 ACAAGAATGAATAATTTGGATGG - Intronic
1037715419 8:21393252-21393274 TCAATTCAGAACAATTTGGAAGG + Intergenic
1038823982 8:30980657-30980679 ACAATTATAAAATTTATGGAAGG + Intergenic
1039256806 8:35727938-35727960 AGAATTATATAAAATTTGGCAGG + Intronic
1039680103 8:39725306-39725328 ACAATAATATAAAATTTGGGAGG - Intronic
1039951221 8:42174235-42174257 ACAAATATGAAAAATTAGCCGGG + Intergenic
1040490848 8:47920954-47920976 AAGATTATGAAAAATGTGGCTGG + Intronic
1040878526 8:52177744-52177766 ATAATTAGGAAACAATTGGAAGG - Intronic
1041998975 8:64099476-64099498 AAAAATATTAAAAATTTGTAGGG - Intergenic
1042365566 8:67932740-67932762 ATAGTTCTGAAAAATCTGGATGG - Intergenic
1043558208 8:81459115-81459137 ACAATCAGGAAAAAGTTAGAAGG - Intronic
1043648961 8:82562766-82562788 AAAATGATGAATATTTTGGATGG + Intergenic
1043785561 8:84394422-84394444 ACAATTTTGATAAATCTGGATGG - Intronic
1044109935 8:88259962-88259984 ACAAATAAGTAAAATTTGGGGGG - Intronic
1044170790 8:89049645-89049667 ACAATTATGGAAGATGTTGAAGG + Intergenic
1044371531 8:91417957-91417979 CATATTATGTAAAATTTGGAAGG - Intergenic
1045070458 8:98498998-98499020 ATAATTCTGAATAACTTGGATGG + Intronic
1047270800 8:123356224-123356246 ACAAAAATAAAAAATGTGGATGG - Intronic
1048039102 8:130707792-130707814 AGAAGTTTGAACAATTTGGAGGG - Intergenic
1049644743 8:143731124-143731146 ACAGTCATGAAATATTTGGGGGG - Intronic
1050751915 9:8948807-8948829 ATAATTCTGGAATATTTGGAAGG + Intronic
1050816937 9:9826407-9826429 ACAATTTTGAAGTATTTTGAAGG + Intronic
1050952616 9:11617115-11617137 GAAGTTATGAAAAATCTGGAAGG - Intergenic
1052723149 9:32197056-32197078 ACACTGATGAAAAAAATGGAAGG - Intergenic
1052848525 9:33359782-33359804 CCAATTATTAACAATTTGCAGGG - Intronic
1053340133 9:37319198-37319220 ACACTCATTAAAAATTAGGAAGG - Intronic
1053491552 9:38508461-38508483 CAGATTATGAAAAATTTGGTAGG - Intergenic
1055322333 9:75094882-75094904 ACAAATATGAAAAAATTAGCTGG + Intronic
1055479265 9:76693818-76693840 ATAATTATGAAGAATTTTGTAGG - Intronic
1055907421 9:81310537-81310559 CCAAATATGAAAAGTTTGTAAGG - Intergenic
1056162815 9:83913964-83913986 ACCATTAAGAACATTTTGGATGG - Intronic
1056281462 9:85045074-85045096 ACAATGAAGAAGTATTTGGAGGG + Intergenic
1056357540 9:85817554-85817576 ACAATTAAAAACATTTTGGATGG + Intergenic
1058466183 9:105230926-105230948 AAAAATATGAAAAATGTGGCTGG + Intergenic
1058543281 9:106034471-106034493 ACATTTTTCAAAAATTAGGAAGG + Intergenic
1058633285 9:107011066-107011088 ACAGTGATGAAAAAGTGGGAGGG + Exonic
1061827577 9:133270228-133270250 ACAATTCTGAGAAATTCGAAAGG + Intronic
1187264744 X:17720623-17720645 ATATTTATCAAAAGTTTGGATGG + Intronic
1187638383 X:21259610-21259632 ATCATTCTGAAAAATTTGAAAGG - Intergenic
1187927848 X:24266416-24266438 ACAATTGTAAAAAATTTAAAAGG + Intergenic
1187961233 X:24568375-24568397 ACAATTTTGAAAAACTTAGCTGG + Intronic
1188115076 X:26232621-26232643 AGAAGTTTGAAAAATTTGGAGGG - Intergenic
1188312710 X:28637265-28637287 CCATTTATTTAAAATTTGGAGGG - Intronic
1188882653 X:35508539-35508561 ATAATTTTGAGAAATTTGAAAGG - Intergenic
1188918214 X:35938414-35938436 AGAATTATTAAAAATATGCATGG - Intronic
1189020861 X:37337973-37337995 GCAATCATAAAAAATCTGGAAGG + Intergenic
1189037936 X:37511796-37511818 ACAATAATTAAACATTTGGGAGG - Intronic
1189215974 X:39324322-39324344 ATAATTCTGAGAGATTTGGAAGG + Intergenic
1189725475 X:43964359-43964381 AGAAATATAAATAATTTGGAGGG + Intronic
1190524627 X:51316316-51316338 AGAATTAAGGAAAGTTTGGAGGG + Intergenic
1190545645 X:51523697-51523719 AGAATTAAGGAAAGTTTGGAGGG - Intergenic
1190716460 X:53108187-53108209 AAAATTAAGAAAAAATTTGAAGG - Intergenic
1191958379 X:66671630-66671652 CCAATTAAGTAAAATTTGCAAGG - Intergenic
1192593704 X:72384354-72384376 ACAATTGTGTAAAAATTGTAAGG - Intronic
1193336862 X:80300074-80300096 AAAATTATTATAATTTTGGAAGG - Intergenic
1193830601 X:86284640-86284662 ACAATTCTGAAAAATAGGGGAGG - Intronic
1194148520 X:90293297-90293319 AAAATTATGAAAAATTCAAATGG - Intergenic
1194352454 X:92837443-92837465 ACTATTTTGGAAAATATGGAAGG + Intergenic
1194570588 X:95549979-95550001 ACTATTCTGAAAAATTTGGGTGG - Intergenic
1195213239 X:102670533-102670555 ACAATAATGAAAAATTGTCAAGG - Intergenic
1196886705 X:120252142-120252164 ATCATTTTGAAAAATTTAGAAGG + Intronic
1196889230 X:120276287-120276309 ACAAATAGAAAAGATTTGGAAGG + Intronic
1197108965 X:122749656-122749678 AAAAATACGAAAAATTTGCAGGG - Intergenic
1197295412 X:124713114-124713136 AAAATTATGAACGATGTGGACGG - Intronic
1197307482 X:124861547-124861569 ACATTTATTAAAAACTTTGATGG + Intronic
1197317127 X:124980928-124980950 GCAATTATAAAAGTTTTGGATGG + Intergenic
1197328236 X:125120899-125120921 AAAAATATGACCAATTTGGAGGG - Intergenic
1197466401 X:126808791-126808813 ACTATGGAGAAAAATTTGGAGGG - Intergenic
1199419647 X:147630095-147630117 ACACGTATGTACAATTTGGAAGG + Intergenic
1200494897 Y:3870035-3870057 AAAATTATGAAAAATTCAAAAGG - Intergenic
1200660763 Y:5954181-5954203 ACTATTTTGGAAAATATGGAAGG + Intergenic
1201398022 Y:13570693-13570715 GCTATTATTAAAAATTCGGAGGG + Intergenic
1201410145 Y:13691318-13691340 AAAATTATTAAGAATTTCGAGGG + Intergenic