ID: 1031483215

View in Genome Browser
Species Human (GRCh38)
Location 7:122302196-122302218
Sequence CAGAAACCCTTGCCGCACGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031483210_1031483215 30 Left 1031483210 7:122302143-122302165 CCAGGCTGCTGTCGTGCAGCTTG 0: 1
1: 0
2: 2
3: 88
4: 897
Right 1031483215 7:122302196-122302218 CAGAAACCCTTGCCGCACGTGGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031483215 Original CRISPR CAGAAACCCTTGCCGCACGT GGG Exonic