ID: 1031483936

View in Genome Browser
Species Human (GRCh38)
Location 7:122306681-122306703
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031483923_1031483936 30 Left 1031483923 7:122306628-122306650 CCTGATGTCTAACAGAAAGGCAG 0: 1
1: 0
2: 2
3: 12
4: 179
Right 1031483936 7:122306681-122306703 CAGGCTGAAGAAATGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr