ID: 1031484996

View in Genome Browser
Species Human (GRCh38)
Location 7:122315116-122315138
Sequence CTCCCATGCCACCGACGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031484986_1031484996 22 Left 1031484986 7:122315071-122315093 CCAAGGCCACAGAGTGCTAGACC No data
Right 1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG No data
1031484995_1031484996 -10 Left 1031484995 7:122315103-122315125 CCAGGGCGCGCGTCTCCCATGCC No data
Right 1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG No data
1031484992_1031484996 -1 Left 1031484992 7:122315094-122315116 CCCAGACCGCCAGGGCGCGCGTC No data
Right 1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG No data
1031484985_1031484996 23 Left 1031484985 7:122315070-122315092 CCCAAGGCCACAGAGTGCTAGAC No data
Right 1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG No data
1031484991_1031484996 0 Left 1031484991 7:122315093-122315115 CCCCAGACCGCCAGGGCGCGCGT No data
Right 1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG No data
1031484987_1031484996 16 Left 1031484987 7:122315077-122315099 CCACAGAGTGCTAGACCCCCAGA No data
Right 1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG No data
1031484994_1031484996 -7 Left 1031484994 7:122315100-122315122 CCGCCAGGGCGCGCGTCTCCCAT No data
Right 1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG No data
1031484993_1031484996 -2 Left 1031484993 7:122315095-122315117 CCAGACCGCCAGGGCGCGCGTCT No data
Right 1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG No data
1031484984_1031484996 24 Left 1031484984 7:122315069-122315091 CCCCAAGGCCACAGAGTGCTAGA No data
Right 1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG No data
1031484990_1031484996 1 Left 1031484990 7:122315092-122315114 CCCCCAGACCGCCAGGGCGCGCG No data
Right 1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG No data
1031484983_1031484996 27 Left 1031484983 7:122315066-122315088 CCTCCCCAAGGCCACAGAGTGCT No data
Right 1031484996 7:122315116-122315138 CTCCCATGCCACCGACGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031484996 Original CRISPR CTCCCATGCCACCGACGTGC TGG Intergenic