ID: 1031485604

View in Genome Browser
Species Human (GRCh38)
Location 7:122319687-122319709
Sequence CAAATTATAATTTATGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 437}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031485604_1031485608 17 Left 1031485604 7:122319687-122319709 CCTGGCACATAAATTATAATTTG 0: 1
1: 0
2: 1
3: 35
4: 437
Right 1031485608 7:122319727-122319749 TAACAAGGATACGACAGTGTTGG 0: 1
1: 0
2: 0
3: 11
4: 77
1031485604_1031485606 2 Left 1031485604 7:122319687-122319709 CCTGGCACATAAATTATAATTTG 0: 1
1: 0
2: 1
3: 35
4: 437
Right 1031485606 7:122319712-122319734 AGGTACACACCATTTTAACAAGG 0: 1
1: 0
2: 1
3: 13
4: 155
1031485604_1031485609 25 Left 1031485604 7:122319687-122319709 CCTGGCACATAAATTATAATTTG 0: 1
1: 0
2: 1
3: 35
4: 437
Right 1031485609 7:122319735-122319757 ATACGACAGTGTTGGTGCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031485604 Original CRISPR CAAATTATAATTTATGTGCC AGG (reversed) Intronic
901098194 1:6699734-6699756 TAAATTATACTTTAAGTTCCAGG - Intronic
904362593 1:29986556-29986578 TAAAGTATATTCTATGTGCCAGG + Intergenic
905419684 1:37832491-37832513 TAAATTATACTTTATGTTCTAGG + Intronic
905555475 1:38879174-38879196 CAAGTTATAATTTAGCTGCTTGG + Intronic
905591961 1:39171919-39171941 AAAATTATAATGTCTGGGCCGGG - Intronic
908281000 1:62534795-62534817 CAAATTATAAATTTTTGGCCAGG + Intronic
908749679 1:67408785-67408807 CAAAATATATTTTATGTTGCAGG + Intronic
909472946 1:76049937-76049959 TAAATTATACTTTAAGTTCCGGG + Intergenic
909753881 1:79198494-79198516 TACATTCTAATTTATGTGCAGGG - Intergenic
910227291 1:84948684-84948706 CAAATCATAAATTATGTTCCTGG - Intronic
911365378 1:96931282-96931304 CAAATAATGATTTATCTGCAAGG - Intergenic
911552712 1:99303802-99303824 CAAATTAAAATTGGTGTGCCAGG + Intronic
911714439 1:101114616-101114638 TAAATTATACTTTAAGTTCCAGG - Intergenic
911719632 1:101177008-101177030 CAACTTTTATTTTATGTCCCAGG + Intergenic
915022078 1:152788633-152788655 AAAATTATAATATATGTGATAGG + Intronic
915695568 1:157738131-157738153 AAAATTATACTTTAAGTTCCAGG - Intergenic
915707149 1:157855579-157855601 CAAATTATATTTTAGGTTCAAGG - Intronic
915792282 1:158686387-158686409 CAAATAATTATTAATGTTCCTGG + Intronic
916440268 1:164818034-164818056 CAAATTATAATTTGGGTTCTTGG + Intronic
916763897 1:167841877-167841899 CAATTATTTATTTATGTGCCAGG - Intronic
917954974 1:180085859-180085881 CAAATGCCTATTTATGTGCCAGG + Intronic
918032158 1:180825452-180825474 CACATTATAGTTTATGTGAGTGG + Intronic
918369624 1:183846518-183846540 AAAATTATACTTTAAGTGCTGGG - Intronic
918596301 1:186298082-186298104 CAAATTAAAATTAATGGGGCTGG + Intronic
918682244 1:187370198-187370220 CAAATTAAAATTGAAGTGCTGGG - Intergenic
918754855 1:188326942-188326964 TATAAAATAATTTATGTGCCGGG + Intergenic
918780626 1:188695341-188695363 CAATTTTTATTTTTTGTGCCTGG + Intergenic
919248390 1:195019078-195019100 CAAATTTTACTTTAAGTTCCGGG + Intergenic
919434511 1:197541020-197541042 AAAATGATAATGAATGTGCCTGG + Intronic
919683981 1:200464397-200464419 CAAAGTACAGTTTCTGTGCCTGG + Intergenic
921449753 1:215291167-215291189 CATATTATAATCTATATTCCAGG + Intergenic
923111069 1:230890516-230890538 GAAATTATAAAGTATTTGCCAGG + Intergenic
923383554 1:233445008-233445030 CTACTTATAATTTAGGTTCCAGG - Intergenic
924734657 1:246744919-246744941 GAAATTATATTTTAGGGGCCGGG - Intronic
1063096040 10:2909938-2909960 GAAATGATAATTTTTGGGCCAGG - Intergenic
1063672253 10:8108641-8108663 AAAATTAAAATTTTTGGGCCGGG - Intergenic
1064286552 10:13996430-13996452 CAAAGTGAAATTTATGTGCCTGG - Intronic
1065018920 10:21486556-21486578 TAAATTTCATTTTATGTGCCTGG - Intergenic
1065452437 10:25872952-25872974 CAACTTTTATTTTATGTTCCAGG - Intergenic
1066357644 10:34700669-34700691 GAAATTAAAATTTATCTGACAGG + Intronic
1066395099 10:35012651-35012673 CAAATTATTATTTATTAGCCTGG + Intronic
1068041912 10:51835568-51835590 AAAGTTATAATTTATGTTCATGG - Intronic
1068487940 10:57683288-57683310 CAAATACAAATTTAGGTGCCAGG - Intergenic
1068677996 10:59787738-59787760 AAAAATGTTATTTATGTGCCTGG - Intergenic
1068831723 10:61503799-61503821 CCAACTATAATTTATGTACTTGG + Intergenic
1068943172 10:62701469-62701491 TCAATTATTTTTTATGTGCCAGG - Intergenic
1069188438 10:65458318-65458340 TAAATTATACTTTAAGTTCCAGG + Intergenic
1069237603 10:66096817-66096839 CAATTTTTAATTTTTCTGCCAGG - Intronic
1069245555 10:66200770-66200792 TAAATTATATTTTATATGCTGGG - Intronic
1071701723 10:87946021-87946043 GAAATGAGAATTTATTTGCCAGG - Intronic
1072388053 10:94952714-94952736 CAAATTGTGATATATGTGCATGG - Intronic
1075677428 10:124305080-124305102 CCAAGCATCATTTATGTGCCAGG + Intergenic
1077819727 11:5725274-5725296 CAAACTATAATTTCTGTTTCAGG - Intronic
1079518325 11:21294057-21294079 TAAATTATACTTTAAGTGCTAGG - Intronic
1079579825 11:22050116-22050138 CAAATTTTATTTTACGTTCCAGG + Intergenic
1079613686 11:22464622-22464644 CAAATTGTACTTGCTGTGCCAGG + Intergenic
1079822946 11:25154550-25154572 CAAATTTTATTTTAAGTTCCAGG + Intergenic
1081078460 11:38707479-38707501 CAAATTATACTTTAATTGTCTGG - Intergenic
1081256287 11:40899915-40899937 AAAATTAAAATGTATGTGTCTGG + Intronic
1081258397 11:40926683-40926705 AAAATTATACTTTAAGTTCCAGG + Intronic
1081313925 11:41607774-41607796 GAAATTATTATTTATATACCTGG - Intergenic
1081756050 11:45545290-45545312 CTAATTGTAATGTATATGCCAGG + Intergenic
1082131568 11:48496401-48496423 CAAATAATATTTTCTGTCCCTGG - Intergenic
1084508403 11:69585927-69585949 TAAATTCTATTTTATGTGTCTGG - Intergenic
1085925449 11:81014204-81014226 AAAAATATAACTTATGTGCAAGG - Intergenic
1085957983 11:81424084-81424106 CACATTCTAAATTCTGTGCCAGG + Intergenic
1086311708 11:85542998-85543020 TTAATTATAATTTAAGTTCCGGG + Intronic
1086683414 11:89702528-89702550 CAAATTATAAGTGATGTTCTAGG + Intergenic
1086812931 11:91333716-91333738 CCAATTTTAAATTATGTTCCTGG - Intergenic
1087234323 11:95701487-95701509 CAGATTACAGTTTGTGTGCCAGG + Intergenic
1088033958 11:105289112-105289134 TCAATTATATTTTATGTGCTAGG + Intergenic
1088092049 11:106053310-106053332 CAAAATGTAATTTATGTTCTTGG - Exonic
1088150309 11:106737409-106737431 TAAATTATACTTTAAGTGCTGGG + Intronic
1088224106 11:107600264-107600286 CAAATTATAAATTTTTTTCCAGG - Intronic
1088418550 11:109617455-109617477 CAACTTTTAATTTAGGTTCCAGG - Intergenic
1088519531 11:110680046-110680068 CAAATTAGACATTATGTGACAGG + Intronic
1090869177 11:130727628-130727650 AAAAATATTATTTATGTGCCTGG - Intergenic
1091581314 12:1791903-1791925 GAAATTACAATTTAGATGCCAGG - Intergenic
1091681381 12:2529654-2529676 TAAAAATTAATTTATGTGCCTGG - Intronic
1092810171 12:12265922-12265944 CAAATTATCATTTTGGTCCCAGG + Intronic
1093213062 12:16330549-16330571 CCAAATATAAATTATGTGACAGG - Intergenic
1093435916 12:19134825-19134847 CTAAATATAGTTTATGTTCCTGG - Intronic
1093703368 12:22247771-22247793 TAAATTAAAATATATGTGACAGG + Intronic
1094123741 12:27000752-27000774 AAAAGTATACTTTATGGGCCGGG - Intronic
1094397001 12:30018039-30018061 CAAATAAGAATTTAAGTACCTGG - Intergenic
1096894417 12:54806634-54806656 TAAATTATACTTTATGTTCTGGG + Intergenic
1097399283 12:59109632-59109654 CAAATAATAATATATTAGCCAGG - Intergenic
1097539314 12:60917304-60917326 AAAATTATACTTAATTTGCCTGG + Intergenic
1097795679 12:63858996-63859018 AAAAATATAATTTATCGGCCAGG - Intronic
1097988794 12:65812904-65812926 AAAAGTACAATTTATGGGCCAGG + Intergenic
1098047513 12:66416061-66416083 CAAATTTTATTTTAAGTTCCAGG - Intronic
1098392803 12:69986974-69986996 TAAATTATACTTTATGTTCTGGG + Intergenic
1098511023 12:71314324-71314346 TAAATTTTACTTTATGTTCCAGG + Intronic
1098569599 12:71973816-71973838 TACATTATAATTTGTGTGTCAGG + Intronic
1099258579 12:80347150-80347172 TAAATTATAATTTATATTCAGGG + Intronic
1099262726 12:80403557-80403579 AAATTTTTAATTAATGTGCCTGG + Intergenic
1099326977 12:81229025-81229047 CAAATTACAGTTTACATGCCAGG - Intronic
1099415240 12:82376818-82376840 AATATTATAATTTATTGGCCGGG + Intronic
1099551172 12:84044967-84044989 ATGATTAAAATTTATGTGCCTGG + Intergenic
1099562750 12:84198330-84198352 AAAATTATAATTTAAGTTCTGGG - Intergenic
1100598877 12:96095221-96095243 CAAACTATAAACTATATGCCAGG + Intergenic
1102756018 12:115341372-115341394 CAAATTATACTTTAAGTTCTGGG + Intergenic
1105214384 13:18275718-18275740 AAAATTATACTTTAAGTTCCAGG - Intergenic
1106336697 13:28789631-28789653 CAAATTATAAATTATGTCTTTGG - Intergenic
1106737417 13:32602103-32602125 AAAATTATACTTTAAGTGCTAGG + Intronic
1106866481 13:33969930-33969952 CAACTTTTATTTTATGTTCCGGG + Intergenic
1107758765 13:43653501-43653523 CAATTTATAATTTATGTTCTTGG + Intronic
1107769099 13:43770981-43771003 GAAATAATAATTTGAGTGCCTGG - Intronic
1107926675 13:45269801-45269823 CAAATTATAATTTATTTTGGGGG + Intronic
1108204430 13:48073511-48073533 TAAATTTCAATTTATGTCCCTGG - Intronic
1109605763 13:64693084-64693106 CAAATTATTCTTTATTTTCCAGG + Intergenic
1109891768 13:68623239-68623261 CAAATTATACTTTAAGTTCTGGG - Intergenic
1110067481 13:71127118-71127140 TAAATTATAATTTAAGTTCTGGG + Intergenic
1110125402 13:71936224-71936246 CAAATTATCATTTTTTTCCCTGG + Intergenic
1110827842 13:79993703-79993725 GAAATTATAATCTATCTCCCTGG + Intergenic
1111175491 13:84590080-84590102 CAAATTATAAAATAAATGCCAGG + Intergenic
1111896449 13:94148177-94148199 CAAATTAAATTTTATGAACCAGG + Intronic
1111989464 13:95102577-95102599 CAAAGTATAATGTAGGGGCCAGG - Intronic
1112408508 13:99141920-99141942 AAAATTATCATTTATCGGCCAGG + Intergenic
1112659510 13:101491636-101491658 TAAATTATACTTTAAGTGCTGGG + Intronic
1112871705 13:103979172-103979194 CAAAGTATAACTAAAGTGCCAGG + Intergenic
1113215945 13:108040864-108040886 CAAATTTTATTTTAAGTTCCAGG + Intergenic
1113298039 13:108983946-108983968 CAAAATAGAATTTATCAGCCTGG + Intronic
1115102156 14:29715089-29715111 TAAATTATACTTTATGTTCTGGG - Intronic
1115140431 14:30164712-30164734 TGAATTCTAATTGATGTGCCTGG - Intronic
1116547141 14:46182655-46182677 AAAATTATACTTTATGTTCTGGG + Intergenic
1116705170 14:48286864-48286886 CAACTTTTAATTTAAGTTCCAGG + Intergenic
1116717248 14:48443089-48443111 AAAATTATACTTTAAGTTCCGGG - Intergenic
1117167658 14:53054764-53054786 AAAATTATAATTTATATTGCAGG + Intronic
1117942575 14:60983807-60983829 AAAATCATAATTTATGCACCAGG + Intronic
1118116941 14:62789177-62789199 CAATATATTATTTATGTGTCTGG + Intronic
1118414639 14:65522583-65522605 AAAATTATACTTTAAGTTCCAGG + Intronic
1118542895 14:66850174-66850196 CAAATTATACATTATTTTCCAGG - Intronic
1118815976 14:69314216-69314238 ATAATCACAATTTATGTGCCAGG + Intronic
1119134679 14:72206118-72206140 CATATTATAATTGATTTACCTGG - Intronic
1120288643 14:82538317-82538339 CACATAATAATTTAATTGCCAGG + Intergenic
1120634555 14:86935457-86935479 GCAATAATAAATTATGTGCCAGG - Intergenic
1122057516 14:99113964-99113986 CAAACTATAATTTAAGAGCAAGG - Intergenic
1122173358 14:99896215-99896237 CATCTTATAATTTGTGTTCCAGG - Intronic
1124948725 15:34295486-34295508 CAAATTAGAATTTAGGTAGCTGG + Intronic
1126012328 15:44314933-44314955 TAAATGATTATTTTTGTGCCAGG - Intronic
1126362460 15:47860515-47860537 CAAATGATAATTTGAGGGCCTGG + Intergenic
1127027500 15:54823587-54823609 CATATTTGAATTTCTGTGCCTGG + Intergenic
1127160240 15:56175304-56175326 CAAATTTTAATTCATGAGCTTGG - Intronic
1128292081 15:66485568-66485590 CAGGTTATAATTTATTTGCGGGG + Intronic
1128464487 15:67898630-67898652 TAAATTATATTTTATGAGACAGG + Intergenic
1132562421 16:602726-602748 CAAAAAATAATTTATTGGCCAGG - Intronic
1135719970 16:24807989-24808011 CAAAGTACAATTTATGTCCCAGG - Intronic
1135856249 16:26013541-26013563 TAAATTTTTATTTAAGTGCCAGG + Intronic
1138041369 16:53672750-53672772 AAAATTATAAGTTATGTACATGG - Intronic
1138149231 16:54640474-54640496 CACATTAAAATTTATTTCCCAGG - Intergenic
1138917418 16:61483185-61483207 AAAATTATACTTTAAGTTCCGGG - Intergenic
1139073268 16:63410616-63410638 CAAGTTATATTTTTTGTGTCTGG - Intergenic
1139552481 16:67682452-67682474 GAAATTATATTTTAAGTGCAAGG - Intronic
1140103797 16:71940798-71940820 CTAATTATAAGCTCTGTGCCTGG - Intronic
1140393472 16:74607701-74607723 GAAATAATAATTTAAGTGCCTGG + Intergenic
1144538029 17:16111064-16111086 CATATAATAATTTATCTGCTGGG - Intronic
1149113765 17:53066056-53066078 CACATTACATTTTATCTGCCTGG - Intergenic
1149258275 17:54851581-54851603 CAAATATTTATTTATGTTCCAGG + Intergenic
1149281553 17:55110801-55110823 AAAAATATTATTTATGTGCTAGG - Intronic
1150038624 17:61833372-61833394 AAAATTATAATTACTGGGCCAGG + Intronic
1150521384 17:65869878-65869900 CAAATTAAAGTTTATCGGCCTGG - Intronic
1150760354 17:67955847-67955869 TAAATTATCATTTATAGGCCAGG + Intronic
1151084427 17:71364380-71364402 TAAATTATATTTTTGGTGCCAGG + Intergenic
1151156383 17:72126228-72126250 CAAAATATGATTTAAATGCCAGG - Exonic
1151858617 17:76741476-76741498 GAAATAATAAATTATGGGCCAGG + Intronic
1152858578 17:82680734-82680756 TAAAATATAATTTCTGGGCCAGG + Intronic
1153004085 18:481920-481942 CAAATTTTATTTTAGGTTCCGGG + Intronic
1155136769 18:23003344-23003366 CAAATCCTAAATTATATGCCTGG - Intronic
1155413266 18:25569275-25569297 CAAACTACAATCTATGGGCCAGG - Intergenic
1155631608 18:27900558-27900580 AAGATTATAATTTATATGCTAGG + Intergenic
1155902855 18:31412260-31412282 CAAATTAGTCTTTCTGTGCCTGG - Intronic
1155973785 18:32106859-32106881 CAAATAATAATTTTTCAGCCGGG - Intronic
1156012368 18:32510104-32510126 CAAATTATAATATGTGTGTTCGG + Intergenic
1156774083 18:40766048-40766070 TAAATTATAATTTAAGTTCTGGG + Intergenic
1156899014 18:42278750-42278772 TTAAGTATATTTTATGTGCCTGG - Intergenic
1157789608 18:50520005-50520027 CTACTTATAATTTTTTTGCCTGG - Intergenic
1158232513 18:55273856-55273878 GAAATTATACTTTTTGTGCATGG + Intronic
1158967462 18:62635089-62635111 CTCATGTTAATTTATGTGCCTGG + Intergenic
1160111491 18:76036492-76036514 CAAATTATACTTTATGTTCTGGG - Intergenic
1164238701 19:23364011-23364033 CAAAATAAAAGTGATGTGCCAGG + Intronic
1165532190 19:36413115-36413137 CAAAGAATAATTTATTGGCCAGG + Intronic
1166629506 19:44392785-44392807 CAAATTATAAAATATGGCCCAGG + Intronic
1166637817 19:44467307-44467329 CAAATTATAAAATATGGCCCAGG - Intergenic
926476081 2:13324318-13324340 TAAATTTTTATTTATGTGCAAGG + Intergenic
928777219 2:34780326-34780348 CAAACAATCATTTATGGGCCAGG + Intergenic
929697496 2:44131561-44131583 CAAATTTTATTTTATGTGCAAGG - Intergenic
930410328 2:51017234-51017256 TAAATTATACTTTAAGTTCCGGG - Intronic
930775836 2:55169514-55169536 CAACTCCTAATTTATCTGCCTGG - Intergenic
930814165 2:55575372-55575394 CAAATTTTAATTTATGTCAAGGG + Intronic
932891705 2:75602602-75602624 CAAATTAGACTGTATGTTCCAGG - Intergenic
933039244 2:77440835-77440857 CAAAATCAAATTTATGTGGCTGG - Intronic
933104604 2:78308244-78308266 CAAATTATAACTTATGTGTTAGG - Intergenic
933210340 2:79559842-79559864 AAAACTACCATTTATGTGCCAGG + Intronic
933529936 2:83495550-83495572 CAAATTATACTTTAGGTTCTAGG - Intergenic
935721588 2:105984368-105984390 GAAATAATAGTTTATGTGCAAGG - Intergenic
935890228 2:107668930-107668952 CAAATTTTATTTTAAGTTCCAGG - Intergenic
937418324 2:121734973-121734995 CCAATTAAAGTTTATGTGCGGGG + Intronic
938206000 2:129424288-129424310 TAAATTATACTTTAAGTGCTAGG + Intergenic
938544139 2:132312526-132312548 CAAATTATAAAATATGGCCCAGG - Intergenic
939530721 2:143357561-143357583 AAAATTATAATTTATTTGACAGG + Intronic
939541542 2:143500654-143500676 AAAATTATAATGTATATACCTGG + Intronic
939941667 2:148358807-148358829 CAAAATATAATTTATTCTCCAGG + Intronic
940379012 2:152992100-152992122 AAAATTATATTTTCTGTGCTTGG + Intergenic
942600257 2:177633882-177633904 AAAATTCTAATTTATGCTCCTGG - Intronic
943426265 2:187738933-187738955 CAAATTGAAATTTTAGTGCCTGG - Intergenic
943930667 2:193847691-193847713 CATAAAATAATTTATGTGGCAGG - Intergenic
943973340 2:194439911-194439933 TAAATTATACTTTATGTTCTGGG + Intergenic
945582815 2:211617419-211617441 TAAATTTTAATATATGAGCCAGG + Intronic
947554972 2:231084051-231084073 GAAATAATAATTTTTGGGCCAGG + Intronic
948960866 2:241335731-241335753 AAAATTATAATTTCTGTTCCTGG - Intronic
1169887363 20:10415129-10415151 CACATTATTATTAATGTGTCAGG - Intronic
1170529083 20:17271497-17271519 CAATTTGTAATTTATTTGCATGG - Intronic
1170748342 20:19120916-19120938 TAAATGAATATTTATGTGCCTGG - Intergenic
1171444265 20:25192683-25192705 AAGATTAAAATTTATGGGCCGGG + Intergenic
1171873002 20:30545258-30545280 CAAATTATAAAATATGGCCCAGG - Intergenic
1172607449 20:36223575-36223597 CAGTTTATACTTTCTGTGCCTGG - Intronic
1172848795 20:37945569-37945591 CAAAGAATAATTTGAGTGCCTGG - Intergenic
1172903267 20:38350298-38350320 CAAGTTCTATTTTATTTGCCGGG - Intronic
1173296257 20:41761281-41761303 TAAATTATACTTTAAGTTCCAGG + Intergenic
1173355325 20:42281919-42281941 CTAATTATAATTGAATTGCCTGG - Intronic
1173445483 20:43113921-43113943 CAAATGATATTTTATGTGCATGG + Intronic
1173683404 20:44904277-44904299 CAAATAAAAATTTATCTGACAGG + Intronic
1174688227 20:52476217-52476239 CACATTAGAATTTCTGTTCCTGG + Intergenic
1174948418 20:55014706-55014728 AAAATTGTAAATTATGTTCCTGG + Intergenic
1175345434 20:58269708-58269730 TAAATTATACTTTAAGTTCCAGG - Intergenic
1175659023 20:60796349-60796371 CAAAGTTTAATTTGTGTGCTGGG - Intergenic
1176726312 21:10437462-10437484 AAAATTATAATTTATGGGCTGGG + Intergenic
1177297351 21:19193386-19193408 CAAATTATATACTATGTGCCAGG + Intergenic
1177475000 21:21608581-21608603 CAAATTTTTATTAATGTGCATGG - Intergenic
1177822661 21:26048630-26048652 CAAACTATAGTTTATGTGTCTGG - Intronic
1178776191 21:35553004-35553026 TAAATTATACTTTAAGTTCCAGG - Intronic
1179448622 21:41452215-41452237 AAAATTATGTTTTATGTTCCCGG - Intronic
1179674508 21:42972930-42972952 CTAATTATAATATATGAGCTTGG - Intergenic
1180176875 21:46095100-46095122 GTAATTATAATTTATGTACTTGG - Intergenic
1180288066 22:10769644-10769666 AAAATTATAATTTATGGGCTGGG - Intergenic
1181332620 22:22105839-22105861 CAAATAATAACTTATTTTCCAGG - Intergenic
949611069 3:5704229-5704251 AAAATTATACTTTAAGTTCCAGG + Intergenic
949930124 3:9071823-9071845 CAAATATTTATTTATGTGTCAGG + Intronic
951049677 3:18080168-18080190 CAAATTATGATTTTTCTCCCTGG + Intronic
951447327 3:22798031-22798053 CATATTATAATGTATCTTCCTGG + Intergenic
951575492 3:24109273-24109295 TAAATTATACTTTAAGTTCCGGG + Intergenic
951853900 3:27173118-27173140 CAAATTGTTATTTATTTGTCAGG + Intronic
951994554 3:28713022-28713044 TAAATTTTATTTTATGTTCCAGG + Intergenic
952571539 3:34723532-34723554 CTAATTATATTTTATTTTCCAGG + Intergenic
953255957 3:41290661-41290683 AACATTATAAAGTATGTGCCAGG + Intronic
954240629 3:49290816-49290838 CAACTGAGAATTTATGTGCTGGG + Intronic
955061046 3:55491638-55491660 CAAATAATATTTTATGGCCCTGG + Intergenic
955272313 3:57513476-57513498 TAAATTTTACTTTATGTTCCGGG - Intronic
955494326 3:59515789-59515811 CCCCTTAGAATTTATGTGCCGGG + Intergenic
956480658 3:69670743-69670765 TAAATTACAATCTATTTGCCTGG - Intergenic
957405525 3:79770986-79771008 CAGAATATAATTTATATGTCTGG - Intergenic
958475345 3:94573818-94573840 CAAATTATAATTACTCTTCCAGG - Intergenic
958539060 3:95446564-95446586 AAATATATAAGTTATGTGCCTGG - Intergenic
959748122 3:109801371-109801393 CACATTGTAGTCTATGTGCCAGG - Intergenic
960551429 3:118980415-118980437 CACATAATACTTTTTGTGCCTGG - Intronic
960908069 3:122621497-122621519 AAAATAATAATTCATGTTCCTGG + Exonic
961209119 3:125111726-125111748 CCAGTGATAATTTATGAGCCAGG - Intronic
962163571 3:133025305-133025327 CAAGTTTTAATTTGTGTACCTGG + Intergenic
962275010 3:134005774-134005796 AAAATTATAATACATGGGCCGGG - Intronic
962816347 3:139004773-139004795 CAAATAAGAATTTAAGGGCCGGG - Intergenic
964817694 3:160734598-160734620 CAAATTATAATTTATCTTTTGGG - Intergenic
965023540 3:163267206-163267228 CAAATTAACATTTATGTGTGGGG - Intergenic
965134829 3:164750454-164750476 TAAATTATACTTTAAGTGCTAGG + Intergenic
965153923 3:165020817-165020839 GAATTAATAATTTATCTGCCAGG - Intronic
965448584 3:168807671-168807693 CAAGTAATAATTGATGTGACAGG + Intergenic
965451066 3:168839160-168839182 CAAATAATAATATATGTGAAAGG + Intergenic
965660722 3:171039241-171039263 TAGATTATCTTTTATGTGCCAGG + Intergenic
965799751 3:172479516-172479538 AAAATTATAATGTATGTGTAAGG + Intergenic
966655052 3:182346745-182346767 AAAATTATACTTTAAGTTCCAGG - Intergenic
968414013 4:413358-413380 CAAAGTTTACTTTATATGCCTGG + Intergenic
969660658 4:8525621-8525643 GAAATGAAAATTTATGTTCCTGG + Intergenic
970553012 4:17202471-17202493 CGAATTATAATTTATCAGCCAGG + Intergenic
970979846 4:22083229-22083251 AAAATTATACTTTAAGTTCCAGG - Intergenic
970996931 4:22278475-22278497 CTAATTATAATGAATGTGTCAGG - Intergenic
971145375 4:23970475-23970497 CAAATCATGATTTATATGCTTGG + Intergenic
971343906 4:25795195-25795217 AATATTATATTTTATGTTCCGGG - Intronic
971563373 4:28111638-28111660 CAAATGATATTTTGTATGCCTGG - Intergenic
973106000 4:46338319-46338341 CAAATTATAATTAGTTTTCCTGG - Intronic
973625501 4:52768183-52768205 TAAATTATACTTTAAGTTCCAGG + Intergenic
974045051 4:56891614-56891636 TAAATTATACTTTATGTTCTAGG - Intergenic
974624638 4:64408148-64408170 GAAATTATATATTATGTGCTTGG + Intronic
974758830 4:66248832-66248854 AAAATTATACTTTATGTTCTAGG - Intergenic
974973472 4:68859900-68859922 AAAACTATAATTTATGATCCTGG - Intergenic
975002268 4:69239108-69239130 TAAATTATAATTTAAGTTCTAGG - Intergenic
975038674 4:69716148-69716170 CATTTTATAATTTTTGTTCCTGG - Intergenic
975940103 4:79632907-79632929 GCAATTATTATATATGTGCCAGG - Intergenic
976087871 4:81424659-81424681 GAATTTATAATTTATGTGGCTGG - Intergenic
976396231 4:84558565-84558587 AAAATTATAATTTAAGTTCTGGG - Intergenic
976632257 4:87251028-87251050 CAATTTATAATTAATTTTCCTGG + Intergenic
976917334 4:90393136-90393158 CAATTTATAATTTATCTTCCTGG + Intronic
977382150 4:96289151-96289173 CCAATTATAACTTACTTGCCTGG - Intergenic
977595793 4:98878168-98878190 ATAGTAATAATTTATGTGCCAGG - Intronic
977629578 4:99227155-99227177 TAAATTATACTTTAAGTTCCGGG + Intergenic
978099337 4:104818269-104818291 AAAATTATACTTTAAGTTCCGGG + Intergenic
978171369 4:105674383-105674405 AACATTGTAATTAATGTGCCTGG + Intronic
978824070 4:113000017-113000039 CAAGTTTTATTTTATGTGCATGG + Intronic
979840334 4:125431579-125431601 TAGAATATAATTTATGTGCTAGG + Intronic
979919848 4:126481943-126481965 AAAATTATACTTTAAGTTCCAGG - Intergenic
980081987 4:128353817-128353839 GAACTTATCTTTTATGTGCCTGG + Intergenic
980192932 4:129548213-129548235 CAATTTTTATTTTATGTTCCGGG + Intergenic
980561591 4:134484037-134484059 CAAATTATACTTTAAGTTCTAGG - Intergenic
981204351 4:142021154-142021176 CCAATTATATTTTATGTCCCTGG - Intergenic
983114557 4:163797028-163797050 CAAATTATAAGATATGTCTCTGG - Intronic
983268173 4:165529956-165529978 CAAATTAGTATTTATGTATCAGG - Intergenic
983527610 4:168775643-168775665 TAAACTATAATATGTGTGCCTGG - Intronic
983687236 4:170425007-170425029 CAAATTCTAAATTTTGTGTCAGG - Intergenic
984358223 4:178692602-178692624 CAAATAAAAACTTATGAGCCAGG - Intergenic
986508337 5:8475738-8475760 CAAATTTTAATTCATGTTCCAGG + Intergenic
987881816 5:23756915-23756937 GAACATATAATTTATATGCCAGG - Intergenic
988251746 5:28768159-28768181 TACATAAAAATTTATGTGCCTGG + Intergenic
990136575 5:52652228-52652250 CTAAATATATTTTATGTGCCAGG + Intergenic
991011423 5:61886888-61886910 CTAATTATTAGATATGTGCCAGG + Intergenic
991662003 5:68959770-68959792 TAAATTATACTTTATGTTCTAGG - Intergenic
991934466 5:71788284-71788306 AAAATAATTATTTACGTGCCAGG - Intergenic
992108239 5:73468342-73468364 CAAATTGGAATTTATGTCACTGG - Intergenic
992246846 5:74834617-74834639 CATATTATAACTGCTGTGCCTGG - Intronic
992406188 5:76459932-76459954 AAAATTATAATTTTTAGGCCAGG - Intronic
992467105 5:77017251-77017273 AAAATAATTATTTATGTGCTAGG - Intergenic
994724251 5:103416014-103416036 CCAATTAGAACCTATGTGCCTGG + Intergenic
994917398 5:105998481-105998503 TAAATTATACTTTAAGTTCCAGG + Intergenic
995990858 5:118238116-118238138 AAAATTATACTTTATGTTCTAGG + Intergenic
996051422 5:118938551-118938573 CAAATAATAATTTACTGGCCAGG + Intronic
996108519 5:119536628-119536650 CAAATTCTGATTTATAAGCCAGG + Intronic
996136576 5:119849650-119849672 AAAAATATAATTTATCAGCCGGG - Intergenic
996212041 5:120822642-120822664 TAAGGAATAATTTATGTGCCAGG - Intergenic
997292257 5:132746618-132746640 CAAAATATAACTTAGGAGCCAGG + Intergenic
997922452 5:137995404-137995426 ATATTTATAATTTATGTCCCTGG - Intronic
998198905 5:140102046-140102068 AAAATTATCCTTTATGGGCCAGG - Intergenic
998539539 5:142967483-142967505 CAAATTAGAATTTAAGAGGCCGG + Intronic
999879756 5:155848878-155848900 CCGAATATATTTTATGTGCCAGG - Intergenic
1000254343 5:159523713-159523735 TAAATTATACTTTAAGTTCCAGG + Intergenic
1000592174 5:163171172-163171194 TAAATTATAATTTAAGTTCTAGG - Intergenic
1000707752 5:164532742-164532764 CATGTTATAATTTATTTTCCAGG - Intergenic
1003230073 6:4243738-4243760 GAAAAAATAATTTTTGTGCCAGG - Intergenic
1004021752 6:11782288-11782310 CACATCATAATTTGTGTTCCTGG + Intronic
1004893370 6:20123124-20123146 AAAATTATAATTTTTTTGGCTGG - Intronic
1005012140 6:21346202-21346224 AAAATTATACTTTAAGTTCCAGG - Intergenic
1005168610 6:22955554-22955576 CAGGTTATAAATTATCTGCCAGG + Intergenic
1005353787 6:24962357-24962379 CAAACCATAATTTATGTCACAGG - Intronic
1006567104 6:34969206-34969228 CAAATGATAACATATGTGTCTGG + Intronic
1008134886 6:47763350-47763372 TAAATTATACTTTAAGTGCTGGG + Intergenic
1009217719 6:60944210-60944232 GAAATGATATTTTATGTACCAGG + Intergenic
1009732741 6:67631549-67631571 CAAAATGAAATTCATGTGCCTGG + Intergenic
1011118166 6:83919492-83919514 TAAATGTTAATTTATGTACCAGG + Intronic
1011396934 6:86920034-86920056 AAAATTATACTTTAAGTTCCAGG - Intergenic
1012057603 6:94433340-94433362 AAAATTATACTTTAAGTTCCGGG - Intergenic
1012277167 6:97288449-97288471 TAAATCATAATATGTGTGCCAGG - Intergenic
1012786079 6:103627805-103627827 AATAATACAATTTATGTGCCAGG + Intergenic
1012795482 6:103754553-103754575 AAAATTAAAAGTTATATGCCTGG - Intergenic
1013051814 6:106543332-106543354 AAAATTTTAATTTGTGTGTCAGG + Intronic
1013499622 6:110735240-110735262 AAAATTAAAATTTGTGTGCTGGG - Intronic
1014192614 6:118515138-118515160 TAAGTTATAATTTTTGTCCCTGG - Intronic
1015651845 6:135470908-135470930 CAAATGTTATTTTATGTTCCAGG - Intronic
1015931917 6:138369181-138369203 CAAATTATACTTTAAGTTCTAGG - Intergenic
1016181321 6:141151471-141151493 CCAATTATAATTAATGTGTTTGG - Intergenic
1016226283 6:141742482-141742504 CAAATTTTATTTTAAGTTCCTGG - Intergenic
1016379188 6:143456361-143456383 AAAATCAGAATTTATGAGCCTGG + Intronic
1017134536 6:151136459-151136481 CAAACGATTCTTTATGTGCCAGG - Intergenic
1019851184 7:3559473-3559495 CAAATTTTTTTTTAAGTGCCAGG + Intronic
1020977843 7:15029035-15029057 CATTTGATAATTTCTGTGCCAGG - Intergenic
1021286713 7:18789378-18789400 CAAAGGAGAATTTATGTGCATGG + Intronic
1021521169 7:21540438-21540460 CAACTAATAATAAATGTGCCAGG + Intergenic
1022391168 7:29945842-29945864 CAAATTATAATTCAGGTGGCAGG + Intronic
1023464817 7:40442733-40442755 AAAATTATACTTTAAGTTCCAGG + Intronic
1023649919 7:42358790-42358812 CAATGTATAATTTATGTTACAGG - Intergenic
1024371037 7:48584092-48584114 AAAATAATAATATATGTACCTGG - Intronic
1024805489 7:53134538-53134560 CAAATAATAATATATCTGACTGG + Intergenic
1025136017 7:56413887-56413909 GAAATTCTAATTTGTGTGCATGG - Intergenic
1025806971 7:64843067-64843089 GAAATAATAATCTTTGTGCCTGG + Intergenic
1025869825 7:65421378-65421400 GAAACTATAATTTTTGTGCTTGG - Intergenic
1028607292 7:92668938-92668960 CAAATTACTATTTTTGTGCAAGG + Intronic
1028667521 7:93363715-93363737 AAAATTATAATTCAAGTGCCTGG - Intergenic
1028966662 7:96809720-96809742 CAAAATATATTTTCTTTGCCAGG + Intergenic
1029991849 7:104969706-104969728 TAAATTGAAATTTTTGTGCCAGG - Intergenic
1030334095 7:108305195-108305217 CAAATAATAAGTTATTTGACTGG - Intronic
1031351691 7:120739963-120739985 CAAATAATTATTTATTTACCAGG - Intronic
1031454372 7:121961245-121961267 CAGATTATGATCCATGTGCCTGG - Intronic
1031485604 7:122319687-122319709 CAAATTATAATTTATGTGCCAGG - Intronic
1031515822 7:122697369-122697391 TAAATTATCTTTTATGTGCTAGG - Intronic
1031589888 7:123577903-123577925 AAAATTATACTTTAAGTTCCGGG + Intronic
1031746312 7:125503090-125503112 GAAATTTAAATTTATGTTCCTGG - Intergenic
1031924468 7:127626058-127626080 CAAATTAAAAATTTTGAGCCAGG + Intergenic
1032479172 7:132232850-132232872 CAAATTGAAATTTGTTTGCCTGG - Intronic
1032684526 7:134219459-134219481 CAAAATATAGTTTTTGTGTCCGG - Intronic
1032811556 7:135424280-135424302 CAAATCTTAATCTATCTGCCTGG + Intronic
1032921958 7:136558991-136559013 TAAATTATAATTATTGTACCTGG - Intergenic
1033466824 7:141599178-141599200 TAAATTATAAATTATGTGTCAGG - Intronic
1034603797 7:152290601-152290623 AAAATTATAATTTATGGGCCGGG - Intronic
1036940863 8:13050376-13050398 CATATAATAAATTATGTGACTGG - Intergenic
1036997236 8:13672559-13672581 CAAATTATAAGGTACTTGCCTGG - Intergenic
1039644339 8:39264122-39264144 CAAATTTTAATTTAGGTTCAGGG + Intronic
1040757105 8:50789989-50790011 AAAATTATAATTCTTGTGTCTGG + Intronic
1041048721 8:53912443-53912465 AATATTAAAATTTATGTGGCAGG - Intronic
1041426691 8:57729167-57729189 CAAATTATACTTTAAGTTCTAGG + Intergenic
1041976842 8:63809111-63809133 CAAATTATCAACTATTTGCCAGG + Intergenic
1042427963 8:68671078-68671100 CAAATTTGAATTTCTGTGTCTGG + Intronic
1042643747 8:70962971-70962993 CAACTTATATTTTAAGTTCCAGG + Intergenic
1043190485 8:77215403-77215425 CAAATCAGAATTTATTTTCCAGG + Intergenic
1043875303 8:85479409-85479431 CATGTTATAATGTATGTGCATGG + Intronic
1043965307 8:86468440-86468462 AAAATTCTAATGTATGTGACAGG + Exonic
1045583991 8:103510333-103510355 CAGATTTTCATCTATGTGCCTGG - Intronic
1046090884 8:109501573-109501595 TACATTTTAATTTCTGTGCCAGG + Intronic
1046122804 8:109866536-109866558 CAAATAATAATTTATTAGCTTGG + Intergenic
1046484012 8:114861468-114861490 CAAATTATAATTTAGGAGACAGG + Intergenic
1046564620 8:115883231-115883253 CAAATCATAATTTCTGTGAGTGG - Intergenic
1046881443 8:119312892-119312914 TAAATTATACTTTAAGTTCCAGG - Intergenic
1047266219 8:123311829-123311851 CAAATTATACTTTAAGTTCTGGG + Intergenic
1047294011 8:123555169-123555191 CACATTACAATTTAGGTTCCAGG + Intergenic
1048200575 8:132370799-132370821 CAAATGCTAAATAATGTGCCAGG + Intronic
1048393699 8:133992282-133992304 CAAATTAGAATTTATATCCCCGG - Intergenic
1048708770 8:137184526-137184548 CAGAGAATAATGTATGTGCCAGG - Intergenic
1048771653 8:137901952-137901974 AAAATTATAATTTATAGGTCAGG - Intergenic
1049142405 8:140967340-140967362 CAAATTATAAGTTATCTGGCTGG + Intronic
1050106481 9:2171566-2171588 GACATTATAGTTTATGTGCCTGG - Intronic
1053443410 9:38134007-38134029 AAATATATAATTTATGAGCCGGG + Intergenic
1055267180 9:74508347-74508369 TAAATTAAAATTTATGTGATTGG + Intronic
1055297672 9:74850931-74850953 CAAATAATGATTCATCTGCCTGG + Intronic
1055320573 9:75080010-75080032 CCATTTATTTTTTATGTGCCAGG + Intronic
1055675434 9:78654609-78654631 CAAATAATAATTCATGAGTCAGG - Intergenic
1055790543 9:79918722-79918744 TAAATTATACTTTAAGTGCTGGG + Intergenic
1055940655 9:81646109-81646131 AAAATTTTAATTTAAGTTCCGGG - Intronic
1056002901 9:82236364-82236386 CAAATTTTACTTTAGGTTCCAGG + Intergenic
1056211926 9:84372892-84372914 CAAAATAGAATTTATATGGCTGG + Intergenic
1056673114 9:88648345-88648367 AAAATTTTAATTTATGTGGCTGG - Intergenic
1056882202 9:90406199-90406221 AAAATTTTAATTTATGTGAGTGG + Intergenic
1058262411 9:102852384-102852406 CAAATTATACTTTAAGTTCTGGG + Intergenic
1058528328 9:105882291-105882313 TAAATTATACTTTATGTTCTAGG + Intergenic
1059786814 9:117595208-117595230 TATATTACTATTTATGTGCCAGG - Intergenic
1059821744 9:117981387-117981409 GAAAATATAATGTGTGTGCCTGG + Intergenic
1060066777 9:120508947-120508969 CATTTTATCATTTCTGTGCCAGG - Intronic
1060954472 9:127628826-127628848 CAGACTATAATTTATGGTCCTGG - Intronic
1061046023 9:128165556-128165578 AAAATTTTAATTTTTGAGCCAGG - Intergenic
1186232821 X:7474162-7474184 CACATTACATTTTTTGTGCCAGG - Intergenic
1186255208 X:7710429-7710451 CAAATTACTATTTATGCTCCAGG + Intergenic
1187108640 X:16272220-16272242 AAAATTATAATTAATATGGCTGG - Intergenic
1187238311 X:17488802-17488824 TAAATTATAATTTAAGTTCTGGG + Intronic
1187541440 X:20199916-20199938 CAAATTATAAACTAAGTGACAGG + Intronic
1187977798 X:24720861-24720883 CAAATTAAAATTTATTTTCTTGG + Intronic
1188138848 X:26523912-26523934 TATATTAAAAATTATGTGCCAGG + Intergenic
1188745619 X:33839113-33839135 CAAATAAGACTTTATATGCCTGG + Intergenic
1189846699 X:45145155-45145177 CAAATTATACTTTAAGTTCTGGG + Intergenic
1190266115 X:48827945-48827967 TAAATTATAATTTAAAAGCCTGG + Intergenic
1191060160 X:56286471-56286493 CAAATTAAAGTTTATGTGATTGG + Intronic
1191176527 X:57507858-57507880 TAAATTATACTTTAAGTTCCAGG - Intergenic
1191201307 X:57785073-57785095 AAAATTATACTTTAAGTTCCAGG - Intergenic
1193285161 X:79705005-79705027 TAAATAATAATTTAAATGCCAGG + Intergenic
1193507143 X:82358773-82358795 CAAATTATACTTTAAGTTCTGGG - Intergenic
1193727310 X:85058072-85058094 AAAATTATATTTTAAGTTCCAGG + Intronic
1193822306 X:86181196-86181218 CAAATTATACTTTAAGTTCTGGG + Intronic
1194199653 X:90938929-90938951 CAACTTTTATTTTATGTTCCAGG + Intergenic
1194225693 X:91254376-91254398 TAAATTATACTTTATGTTCTGGG + Intergenic
1194521566 X:94924971-94924993 TGTATTATAATTTATGAGCCAGG - Intergenic
1194640139 X:96393893-96393915 CAGATTATCATTTAAGTGTCTGG + Intergenic
1194950006 X:100114492-100114514 CAATTTTTACTTTATGAGCCTGG - Intergenic
1194955687 X:100177321-100177343 CATAGTATATTTTATGTACCTGG + Intergenic
1195216381 X:102707909-102707931 CAAATTATAATTTTTATTCCTGG - Intergenic
1196553325 X:117056815-117056837 CAACATATAATTTAAGTCCCGGG - Intergenic
1196618118 X:117791266-117791288 AAAATAATAATTTGTGTGCTGGG - Intergenic
1196921761 X:120592733-120592755 AAAATTAAAATTTATGGGCCGGG + Intergenic
1197943246 X:131811782-131811804 CAAATTAAAATTTATCGGCCAGG + Intergenic
1198346649 X:135766358-135766380 AAAATTATACTTTAAGTTCCGGG - Intronic
1198348556 X:135783645-135783667 AAAATTATACTTTAAGTTCCGGG - Intergenic
1198352368 X:135818181-135818203 AAAATTATACTTTAAGTTCCGGG - Intronic
1198354277 X:135835451-135835473 AAAATTATACTTTAAGTTCCGGG - Intronic
1198358100 X:135869979-135870001 AAAATTATACTTTAAGTTCCGGG - Intergenic
1198360014 X:135887258-135887280 AAAATTATACTTTAAGTTCCGGG - Intronic
1199184560 X:144899784-144899806 AAAATTATAATTTTATTGCCTGG + Intergenic
1200293849 X:154897669-154897691 GAAATCATGATTTTTGTGCCTGG - Intronic
1200545642 Y:4515346-4515368 CAACTTTTATTTTATGTTCCAGG + Intergenic
1200562236 Y:4719262-4719284 TAAATTATACTTTATGTTCTGGG + Intergenic
1200737975 Y:6820830-6820852 TAAATTATACTTTAAGTGCTGGG - Intergenic
1201686367 Y:16707694-16707716 TAAATTATACTTTATGTTCTGGG - Intergenic
1201898988 Y:19026797-19026819 CAAATAATTATGTATGTACCAGG - Intergenic