ID: 1031492902

View in Genome Browser
Species Human (GRCh38)
Location 7:122411119-122411141
Sequence TCTGATCTGCTGATGGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031492902_1031492905 4 Left 1031492902 7:122411119-122411141 CCATCTACCATCAGCAGATCAGA 0: 1
1: 0
2: 0
3: 11
4: 158
Right 1031492905 7:122411146-122411168 TGTTAGTATCTTTTGATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031492902 Original CRISPR TCTGATCTGCTGATGGTAGA TGG (reversed) Intronic
900297423 1:1958957-1958979 CCTGAGCTGCTGTTGGAAGAAGG + Intronic
903130754 1:21278155-21278177 TCTATTCTTCTGATGGCAGATGG - Intronic
904163528 1:28538127-28538149 TCTGTTCTGCTGATGAGAAAAGG - Exonic
904532398 1:31177879-31177901 TCTGATCTTCTGCTGATAGCGGG - Intergenic
905881235 1:41465370-41465392 TCTAGTCTGCTGATGGAAGTTGG - Intergenic
906521895 1:46472055-46472077 TGTGCTCTGCAGATGGTAGTAGG + Intergenic
907433536 1:54429237-54429259 TCTGAGCTGCTGATTGTATAGGG + Intergenic
907455481 1:54572656-54572678 TGTGGTCTGCTGGAGGTAGAGGG + Intronic
908790412 1:67775535-67775557 TCTGATGAGCTGCTGGTGGATGG + Intronic
911345011 1:96685951-96685973 TCTGATCTGATGCAGGGAGAAGG - Intergenic
912244553 1:107947420-107947442 TCTGATCTTCTCATGGTATAGGG - Intronic
912434344 1:109649500-109649522 TCTGCTCTGCAGATGGAAAATGG + Intergenic
914050538 1:144126709-144126731 TGTGAGCTGCTGCTGGTAGTAGG - Intergenic
914128644 1:144838736-144838758 TGTGAGCTGCTGCTGGTAGTAGG + Intergenic
919235909 1:194842324-194842346 TCTCATCTGCTGAAGCTGGAGGG + Intergenic
921049624 1:211501677-211501699 TCTGATTTGCTGATGCCACAAGG - Intergenic
923105848 1:230853091-230853113 TCTGATCGCCTGATGGGAGCTGG - Intronic
1063679029 10:8169358-8169380 TCTGAGCTGCTCATGGTCCATGG + Intergenic
1067671323 10:48324819-48324841 ACTGATCTGCTGATTGTCAAGGG - Intronic
1069572733 10:69504170-69504192 CCTGATCTGCTGCTAGTGGAGGG + Intronic
1071510222 10:86256842-86256864 TCTGATCTGCTGATGCTTCCCGG - Intronic
1072581102 10:96740796-96740818 TCGGATTGGCTGATGGTTGAGGG - Intergenic
1074894506 10:117763280-117763302 TCTGATCCTCTGATGGGAGCTGG - Intergenic
1076013927 10:127012838-127012860 GCTGACCTGCTGCTGGCAGAAGG + Intronic
1078758848 11:14235569-14235591 TTTGGTATGCTGAGGGTAGAAGG + Intronic
1082216631 11:49578367-49578389 CCTGATCTTCTGAAGCTAGAAGG - Intergenic
1085918398 11:80920596-80920618 TCTGATGTGATGATGCTAGGTGG + Intergenic
1086632923 11:89045720-89045742 ACTGATCTTCTGAAGCTAGAAGG + Intronic
1088462634 11:110097913-110097935 ACAGTGCTGCTGATGGTAGAAGG + Intronic
1089200155 11:116719905-116719927 TCTGACCAGCTGCTGGAAGAAGG - Intergenic
1091987162 12:4920128-4920150 TCTGAACATCTGATGATAGAGGG - Intronic
1092063183 12:5567167-5567189 TGTGATCAGCTGTTGGGAGAGGG - Intronic
1093998738 12:25671482-25671504 TATGATCTCCTTATGGTAAAAGG + Intergenic
1095772152 12:45971756-45971778 AATGATCTGGTGATGGTAGTGGG + Intronic
1104553988 12:129783289-129783311 TCTGACCCTCTGAAGGTAGATGG - Intronic
1112051972 13:95651926-95651948 TGTGATCTGCTGTTATTAGATGG - Intergenic
1112371179 13:98795125-98795147 TATGATCTGGTGAGCGTAGAAGG - Intronic
1115096002 14:29636449-29636471 TCTGATGTGGTCATGGAAGAAGG - Exonic
1117667567 14:58072809-58072831 TTTAATTTGCTGATGGTAGGTGG + Intronic
1118395243 14:65330591-65330613 TGTGTTTTGTTGATGGTAGAAGG + Intergenic
1119799981 14:77435360-77435382 TCTGTCCTGCTGATTCTAGATGG + Exonic
1122792488 14:104190192-104190214 TCTGAGCTGCTGCCGGGAGAAGG + Intergenic
1123420410 15:20126019-20126041 TGTGAGCTGCTGCTGGTAGTGGG - Intergenic
1123445447 15:20327505-20327527 TGTGAGCTGCTGCTGGTAGTGGG + Intergenic
1123529634 15:21132555-21132577 TGTGAGCTGCTGCTGGTAGTGGG - Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1128416095 15:67447501-67447523 ACTAATTTGGTGATGGTAGAGGG - Intronic
1128681089 15:69652179-69652201 TCTGATGTCCTGATGGCAGCAGG - Intergenic
1130815378 15:87426579-87426601 GCTGATATGCAGATGGCAGAAGG - Intergenic
1133416841 16:5613436-5613458 TCATATCTGCTGATGGCACAGGG + Intergenic
1133985443 16:10664815-10664837 TCTCATCTGCTGATGTGGGAGGG - Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1136721301 16:32321093-32321115 TGTGAGCTGCTGCTGGTAGTGGG - Intergenic
1136839684 16:33527379-33527401 TGTGAGCTGCTGCTGGTAGTGGG - Intergenic
1138214507 16:55191482-55191504 TCTGATCAGCATATTGTAGAAGG + Intergenic
1203005131 16_KI270728v1_random:196677-196699 TGTGAGCTGCTGCTGGTAGTGGG + Intergenic
1203136681 16_KI270728v1_random:1732798-1732820 TGTGAGCTGCTGCTGGTAGTGGG + Intergenic
1203149850 16_KI270728v1_random:1827664-1827686 TGTGAGCTGCTGCTGGTAGTGGG - Intergenic
1144584813 17:16481788-16481810 TCTGATTTCCTCATGGTAAATGG - Intronic
1148433572 17:47663067-47663089 TCTGATCTGCTGTTCATAAAAGG + Exonic
1150311448 17:64131983-64132005 TTTCATCTGCTGATGTTACAGGG - Intergenic
1150591452 17:66566189-66566211 TCAGATCTGCTGATGATACCTGG + Intronic
1151166382 17:72207314-72207336 TATCCTCTGCTGATGGTAGTTGG - Intergenic
1151803960 17:76393993-76394015 TCAGCTCTGCTGAGGGAAGATGG - Intronic
1153742635 18:8144959-8144981 TCTGATCTGGTCATGGAAGGAGG + Intronic
1154033326 18:10773381-10773403 TCTGACCAGCTGCTGGTAGTGGG + Intronic
1157930556 18:51817197-51817219 TCTCATCTATTGTTGGTAGAAGG - Intergenic
1158526142 18:58216148-58216170 TCTTCTCTGCTGATGATAAATGG - Intronic
1160502173 18:79407084-79407106 TCTGATCTGCTGGTGATACCTGG - Intronic
1161651098 19:5485576-5485598 GCTGATCTGCAGATGTGAGAAGG + Intergenic
1162877746 19:13633338-13633360 TTCATTCTGCTGATGGTAGATGG - Intergenic
1164649384 19:29881016-29881038 TCTGAGCTGCAGCTGGGAGAGGG + Intergenic
1166430585 19:42723279-42723301 TCTGCAGTGCAGATGGTAGAGGG + Intronic
1168700723 19:58437842-58437864 TCTGGGCAGCTGATGGTTGAAGG - Intronic
1202689945 1_KI270712v1_random:79347-79369 TGTGAGCTGCTGCTGGTAGTAGG - Intergenic
925178767 2:1803030-1803052 TCTGTTCTGCTGATGTCAGCAGG - Intronic
927002591 2:18814056-18814078 ACTGATCTGCTAATGGCTGATGG + Intergenic
927081510 2:19635254-19635276 TCTTCTCTGCTGATGGGAGGTGG - Intergenic
927293620 2:21428274-21428296 TCTGAGTTGTTGATGGAAGAAGG - Intergenic
927381530 2:22484964-22484986 TTTGATCAACTGATGGTACAGGG - Intergenic
927523692 2:23718833-23718855 TGTGATCTGAAGATGGAAGAAGG - Intergenic
933446500 2:82386963-82386985 TCAGAGCTGCTGCTGGGAGATGG - Intergenic
933757194 2:85649049-85649071 TCTGCCCTGCTGAAGCTAGATGG - Exonic
933956473 2:87376676-87376698 TGTGAGCTGCTGCTGGTAGTGGG + Intergenic
934240619 2:90268702-90268724 TGTGAGCTGCTGCTGGTAGTAGG + Intergenic
934272573 2:91548057-91548079 TGTGAGCTGCTGCTGGTAGTAGG - Intergenic
935154639 2:100472628-100472650 TCTGATCTGATGTTGTTAAAAGG - Intronic
935361044 2:102246509-102246531 TCTACTCTGCTCATGGGAGATGG + Intergenic
936148626 2:109997969-109997991 TGTGAGCTGCTGCTGGTAGTGGG - Intergenic
936196052 2:110373399-110373421 TGTGAGCTGCTGCTGGTAGTGGG + Intergenic
937144395 2:119629939-119629961 TCTGACCTGCAGATTGAAGAAGG - Exonic
937798913 2:126058946-126058968 TCTGCTCTGCTGGTGGTAGCAGG + Intergenic
938587533 2:132706339-132706361 TCAGTTCTGCTGATGGAAGGAGG + Intronic
939676372 2:145077627-145077649 TCAGATCAGCAGCTGGTAGAAGG - Intergenic
942646458 2:178115657-178115679 TCTGATCCACTGCTGGTAAAGGG - Intronic
944923068 2:204435639-204435661 TTTGATCTCCTGATGCTGGAGGG - Intergenic
946240776 2:218354175-218354197 TCGGATCTGCTGATGGGAGCTGG - Intergenic
947920056 2:233862537-233862559 TCTGTTCTGCTGACAGTAGGTGG + Intergenic
948236366 2:236393956-236393978 GCTGATATGGTGATGGTAAATGG + Intronic
1169148598 20:3271212-3271234 TCTGAACTGGTGAAGGTAAATGG - Intronic
1170117216 20:12873225-12873247 CCTCATTTGCTGATGGTAGCAGG - Intergenic
1176970301 21:15257394-15257416 TCTCATTTGCTGATGGTTGAGGG + Intergenic
1178255220 21:31046137-31046159 TCTTATATCCTGATGATAGAAGG + Intergenic
1179214518 21:39355459-39355481 TGTGTTCTGCTGCTGTTAGATGG - Intergenic
1179482426 21:41686665-41686687 TCCGATCTGCTGATATTAGGAGG + Intergenic
1179513748 21:41892332-41892354 TCTGAGCTGCTGGTGCTAGCAGG - Intronic
1180551471 22:16545215-16545237 TGTGAGCTGCTGCTGGTAGTGGG + Intergenic
1181181863 22:21074109-21074131 GCTCATCTGCTCATGGGAGATGG - Intergenic
1181352529 22:22268708-22268730 TGTGAGCTGCTGCTGGTAGTGGG - Intergenic
1183931103 22:41236723-41236745 TCTCTTCTGCTGAGGGAAGATGG - Intronic
1183978276 22:41525586-41525608 TCTGATCAGCTGCTGCTGGATGG - Intronic
1185158875 22:49210677-49210699 TCTGAACTGATGTTGGCAGAAGG + Intergenic
949448441 3:4161332-4161354 TCCCACCTGCTGATTGTAGAGGG - Intronic
949653451 3:6188647-6188669 GCTGATATGCTGATTGGAGATGG + Intergenic
949932480 3:9089706-9089728 TCTCATCTTCTGTTAGTAGAAGG - Intronic
952258473 3:31715827-31715849 TCTCATCTGCGGATGGTAAATGG + Intronic
953182494 3:40609151-40609173 TCAGAGCTGCTGCTGGTAAAGGG + Intergenic
957253437 3:77805129-77805151 TCTTATTTTCTGCTGGTAGAGGG + Intergenic
960814802 3:121661542-121661564 GCTGGTCAGCTGATGGAAGAAGG + Intergenic
962650548 3:137484578-137484600 TTTGATCTTGTGAAGGTAGAGGG - Intergenic
964104488 3:153024278-153024300 TTTGATCTGTTGAGGGCAGATGG - Intergenic
964155000 3:153574433-153574455 TCTCACCTGCTGATGATATAAGG - Intergenic
964601404 3:158504392-158504414 CCTGATCTGATCATGGCAGATGG - Intronic
965771463 3:172186156-172186178 TTTGTTCTACTGATGGAAGAAGG - Intronic
966742700 3:183249255-183249277 TCTGATCTGCTGCTGGGAAAAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968019877 3:195375932-195375954 TCTAATTTGCTGTTGGTATAAGG - Intronic
968041018 3:195589376-195589398 TCTGCTCTGATGATGGTGGAGGG + Intergenic
969514172 4:7637353-7637375 TCTCCTCTGCTGAAGGTAGTGGG + Intronic
972887128 4:43506297-43506319 TCTGAACTGCTGCTTTTAGAGGG - Intergenic
975728703 4:77317278-77317300 TCTCATCTGCTGATGGCTCAGGG - Intronic
975836804 4:78431179-78431201 TCTTTGCTACTGATGGTAGATGG + Intronic
984567792 4:181351614-181351636 TATGCTCAGCTGGTGGTAGAAGG - Intergenic
996572807 5:124950699-124950721 TCTGAAGTGCTGAAGGTTGAAGG - Intergenic
1000706476 5:164519425-164519447 TCTGAAGTGGTGATGGTGGAGGG + Intergenic
1001670368 5:173468552-173468574 TATCATCTGCTGATAGTCGAAGG + Intergenic
1002602244 5:180360676-180360698 TCGGATGTGCTGAGGGGAGAGGG + Intergenic
1002873980 6:1194373-1194395 TCTTATCTATTGATGGAAGATGG - Intergenic
1005268185 6:24135254-24135276 TTGGATATGCTGATGGTAGAAGG + Intronic
1007252418 6:40505004-40505026 TGTGATGTGATGATGGCAGAGGG + Intronic
1008601054 6:53095551-53095573 TCTGATCTGCTTCTTGTACAGGG - Exonic
1010253163 6:73729455-73729477 TCTGGTCTGCTAATGCTAGAAGG + Intronic
1010759462 6:79706430-79706452 ACTGTTCTGCAGATTGTAGATGG - Intergenic
1016581046 6:145629615-145629637 TCTGTTCTGCTGAGGGTATGAGG + Intronic
1020874921 7:13681267-13681289 TCTGATCTGTTGATTTTATAAGG + Intergenic
1022548948 7:31218526-31218548 TCTGACCTGCTGTGGGCAGAGGG - Intergenic
1023264721 7:38393032-38393054 TCTAGTCTGCTGATAGCAGAGGG - Intronic
1023702293 7:42904721-42904743 GCTGATTTGCTGGTGGTGGAAGG + Intergenic
1027793781 7:82666198-82666220 TCTGCTCTGATGATGGAGGATGG - Intergenic
1028038715 7:86019737-86019759 TCTGCTCTGCTGACAATAGATGG + Intergenic
1030482478 7:110121458-110121480 TCTGTTATCCTGATGGTAGCTGG - Intergenic
1031492902 7:122411119-122411141 TCTGATCTGCTGATGGTAGATGG - Intronic
1031692042 7:124800711-124800733 TCTAATCTGCTGATGGCAACTGG - Intergenic
1032774944 7:135102667-135102689 TATGATCTGGAGATGGGAGATGG - Intronic
1034100464 7:148445921-148445943 TCGGAGCTGCTGCTGGAAGATGG + Intergenic
1036730189 8:11256119-11256141 CCGGATCTGCTGATGGGAGTTGG - Intergenic
1038874369 8:31532029-31532051 TCTTATCTTCTAATGGTTGAAGG + Intergenic
1041447198 8:57965300-57965322 TCTGATCTACTTATGAAAGAAGG + Intergenic
1043546439 8:81320866-81320888 TCTGCTCAGCTGCTGGCAGAAGG - Intergenic
1045372704 8:101540733-101540755 TGGGATCTCCTAATGGTAGATGG - Intronic
1049317217 8:141975650-141975672 TCTGATCTGTTGAGGGGAAATGG - Intergenic
1053512695 9:38702289-38702311 TCTTCTCTGCTTATGGAAGAAGG + Intergenic
1055235607 9:74119221-74119243 TCTGATCCCCACATGGTAGAAGG + Intergenic
1056665245 9:88576568-88576590 TCTGCTCTCCTGAGGGGAGAAGG + Intronic
1057750264 9:97787301-97787323 GGTGGTCAGCTGATGGTAGAGGG - Intergenic
1060656592 9:125376427-125376449 TCTGATCTGCTGATGCCGGCTGG - Intergenic
1191167870 X:57410327-57410349 TGTGTTCTGCTGCTGCTAGATGG + Intronic
1192361560 X:70444270-70444292 TCTTTACTGGTGATGGTAGAAGG + Intergenic
1198301622 X:135339177-135339199 TCTTATCTGTTGAAGATAGAGGG - Intronic