ID: 1031493553

View in Genome Browser
Species Human (GRCh38)
Location 7:122419046-122419068
Sequence CAGACTCATGAGCCTGTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031493553_1031493554 12 Left 1031493553 7:122419046-122419068 CCTATTACAGGCTCATGAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1031493554 7:122419081-122419103 ACTAGATCAAAGTCAGCAACTGG 0: 1
1: 0
2: 1
3: 7
4: 116
1031493553_1031493555 13 Left 1031493553 7:122419046-122419068 CCTATTACAGGCTCATGAGTCTG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1031493555 7:122419082-122419104 CTAGATCAAAGTCAGCAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031493553 Original CRISPR CAGACTCATGAGCCTGTAAT AGG (reversed) Intronic
905978397 1:42198548-42198570 AAGACTCATGTTCTTGTAATAGG + Intronic
906356699 1:45112972-45112994 CAGACTCGCAAGCCTATAATAGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
910865103 1:91781112-91781134 CAGACCCATGAGACTATCATAGG - Intronic
915092116 1:153433878-153433900 GAGACCCCTGAGCTTGTAATTGG + Intergenic
915733056 1:158067585-158067607 CAGGCTCCTTAGCCTGTAAAAGG - Intronic
915773825 1:158460539-158460561 CAGACACATGGGGCTGTACTAGG + Intergenic
918046578 1:180945192-180945214 CAGACTTAAGAGCCTGGCATTGG - Intronic
921677960 1:217997851-217997873 CAGACACAGGTGCCTATAATAGG - Intergenic
923296452 1:232599281-232599303 CAGACTCATTAAGCTGTTATTGG - Intergenic
1063137944 10:3233428-3233450 CAGACAGATGAGCCTGTACCTGG + Intergenic
1067689137 10:48490129-48490151 CAGACTCATGCACCTGTAGGGGG + Intronic
1075734113 10:124653605-124653627 CAGACTCATGAGCCAGACTTGGG + Intronic
1079560425 11:21813359-21813381 CAGGCTCATGAGAGTGTAATGGG + Intergenic
1080984031 11:37440138-37440160 CAGACTTTTGAGCCTAGAATAGG - Intergenic
1083085019 11:60134083-60134105 TAGGCTCCTGGGCCTGTAATGGG - Intergenic
1083601816 11:63953469-63953491 CAGTCTGATCAGCCTGTGATGGG + Intronic
1093187573 12:16038751-16038773 CATGCTCATCAGCCTCTAATAGG - Intergenic
1094586727 12:31783723-31783745 CAGACTCTTGAGCAAGGAATTGG + Intergenic
1094770119 12:33647767-33647789 CACACTCTGGAGCCTGTCATGGG - Intergenic
1094804792 12:34079037-34079059 CACACTCAGGGGCCTGTCATGGG + Intergenic
1095970461 12:47898239-47898261 CACACACATGAGCCAGAAATTGG + Intronic
1098885230 12:75954105-75954127 CTTACTAATGAGCCTGTGATGGG - Intergenic
1098972164 12:76868222-76868244 CAGAGTCATCAGTCTGTACTTGG + Intronic
1100481283 12:94982099-94982121 CAGACTCATAAGACTATCATAGG + Intronic
1100874258 12:98945599-98945621 CAGACTCAGGAGTTTGTAAATGG - Intronic
1101843709 12:108345389-108345411 CAGAATCAAGACACTGTAATAGG - Intergenic
1103225714 12:119285580-119285602 CACACTCATGAGCTTGGAAGAGG - Intergenic
1104159014 12:126160969-126160991 CAGACTCATGTTCCTGTAGTAGG - Intergenic
1108571763 13:51758708-51758730 CAGACTAAAAAGACTGTAATAGG + Intronic
1109311485 13:60699663-60699685 CAGGCTCAGAAGCCTGCAATGGG + Intergenic
1112589891 13:100753315-100753337 CAGCCTTATGATCCTGTCATTGG + Intergenic
1114473442 14:22979261-22979283 CTCACTCATGGGCCTGGAATTGG - Intronic
1120731982 14:88013771-88013793 CTGAGTCATAAGCCTGCAATGGG + Exonic
1128535453 15:68486852-68486874 CAGAGCCATGAGCCTCTGATAGG + Intergenic
1136303235 16:29350751-29350773 GCTACTCATGAGCCTGAAATGGG + Intergenic
1137735077 16:50717765-50717787 CAGACTCACAAGCCTGGAATAGG + Intronic
1140352035 16:74271392-74271414 CAGGCTGATAAGCCTGTAGTAGG - Intergenic
1141503725 16:84461586-84461608 CCGATTCATGAGCTTGTAAGTGG + Intronic
1144635734 17:16907773-16907795 CAGACTCATGTGCTTTTACTGGG - Intergenic
1147431272 17:40372186-40372208 CAGCCTCATGATCCTGGACTTGG + Intergenic
1147632088 17:41938743-41938765 CAGGCTCTTGAGGATGTAATGGG - Exonic
1147663623 17:42130817-42130839 CAGAACCATGAGCCTGAAGTTGG - Intronic
1148142610 17:45339154-45339176 CAGACTCAGGAGCCTGAGGTGGG + Intergenic
1149367906 17:55964234-55964256 CTGAATCCTGAGCCTGGAATGGG + Intergenic
1150897571 17:69231523-69231545 CATCCTCATGAGCCACTAATGGG - Intronic
1153713471 18:7822812-7822834 CACACTCATGAGCCTATTCTTGG + Intronic
1159119539 18:64152769-64152791 CAGATCCATGAGCGTGTAAATGG - Intergenic
1159328374 18:66954077-66954099 CACACACAGGGGCCTGTAATGGG + Intergenic
1165113369 19:33514635-33514657 CAGCCTCATGTGCCTGTCGTTGG - Intronic
1166884825 19:45953971-45953993 CACACTCATGAGACAGGAATGGG + Intronic
926161508 2:10493371-10493393 CACACTCATGAGCGTATAGTAGG + Intergenic
928808854 2:35198088-35198110 TAGGCTTCTGAGCCTGTAATGGG - Intergenic
935612855 2:105043854-105043876 CAAACTCCTGAGCTTGTGATCGG + Intronic
939168630 2:138667346-138667368 CAGACACATCAGCCTATAACTGG + Intergenic
941106317 2:161358556-161358578 CAGATTAATGAGGTTGTAATGGG - Intronic
1170558174 20:17532120-17532142 CCCACCCATGGGCCTGTAATAGG + Intronic
1171126920 20:22610592-22610614 CAGCCTCATGAGCTTGGAAGTGG - Intergenic
1173861526 20:46286848-46286870 CAGACAGATGAGTCTGGAATTGG - Intronic
1173912395 20:46679966-46679988 CAGAGTCATCAGCCTGTAAATGG - Intronic
1175528998 20:59661329-59661351 CAGACTCATGGGCCTGTCGTTGG - Intronic
1175529178 20:59662475-59662497 CAGACTCATGGGCCTTTCGTTGG - Intronic
1177299368 21:19221533-19221555 GAGACTGATCAGACTGTAATGGG - Intergenic
1183042478 22:35192718-35192740 CAGTCTCATGAGGCTGTCACTGG - Intergenic
1183345341 22:37304344-37304366 CAAACTCCTGAGGCTGTCATTGG - Intronic
1183723905 22:39578047-39578069 CAGGGTCCTGAGCCTGCAATGGG + Intronic
1184275657 22:43408276-43408298 CAGACTCATGAGCTGTTAAATGG + Intergenic
1185223947 22:49642666-49642688 CAGACAGATGAGCCTGTGCTGGG - Intronic
952809087 3:37385474-37385496 CAGCCTCAAGAGCCTGTGATGGG - Intergenic
953257174 3:41303238-41303260 CAAACTCAGGAGCCTATACTGGG + Intronic
956070224 3:65441474-65441496 CAGATTCATGTGCCTGTTAATGG - Intronic
959429186 3:106231593-106231615 CAGACTCACTAGCCTGGAAGGGG - Intergenic
959551951 3:107669910-107669932 CTGACTCATGAGCATGGAAATGG + Intronic
960303586 3:116034079-116034101 CTGTCTCATGTGCTTGTAATGGG - Intronic
963588656 3:147227992-147228014 CACACTCAGGGGCCTGTCATGGG - Intergenic
964660732 3:159117393-159117415 CAGAATCTAGAGCCTGGAATTGG - Intronic
967260277 3:187634862-187634884 CAGGCTTCTGAGCCTGTGATGGG + Intergenic
967271340 3:187736065-187736087 AAGACTCAGCAGCCTGGAATGGG - Intronic
970890476 4:21038450-21038472 CAGTCTCATGAGGCTGTGACTGG + Intronic
971740824 4:30518505-30518527 CAGACTCATCAAACTGTGATAGG - Intergenic
975059338 4:69978317-69978339 CAGAATGATGAGCCTGGAATGGG + Intergenic
975837752 4:78442286-78442308 CAGACTCATGTGCCTTGAGTGGG + Intronic
982479961 4:155897226-155897248 CACACACAGGAGCCTGTCATGGG + Intronic
987259620 5:16190074-16190096 GAGACACAGGACCCTGTAATTGG + Intergenic
987935634 5:24460867-24460889 CACAATCTTGAGCCTGCAATTGG - Intergenic
989236695 5:39156229-39156251 CAGGCTTATGAGACTCTAATGGG + Intronic
993692716 5:91022670-91022692 AAGATTTATGAGCCTGTAAATGG - Intronic
998981635 5:147710044-147710066 TAGAGTGATCAGCCTGTAATAGG + Intronic
999174537 5:149622683-149622705 AACACTCAAGAGCCTGTAAAAGG + Intronic
1001881585 5:175249361-175249383 CAAACTCATGATCTTGTCATAGG + Intergenic
1003305334 6:4922055-4922077 CAGCCTCATGGGCCTGAATTTGG + Intronic
1006059801 6:31411584-31411606 CAGAATCCTGAGCCTGTGGTGGG + Intronic
1010192654 6:73209682-73209704 CAGACTCATGTGACTGTAGTTGG - Intergenic
1010196197 6:73242132-73242154 CAGACTCGTGTGACTGTAGTCGG - Exonic
1012519422 6:100103214-100103236 CAGACTAAAGAGCCTGTGATTGG - Intergenic
1018676387 6:166226008-166226030 CACACACATGGGCCTGTCATGGG + Intergenic
1022345465 7:29510065-29510087 CAGTCTCAGGAGCCTGGAAAGGG - Intronic
1023585534 7:41725879-41725901 CAGACACATGACACTGTAGTTGG - Intergenic
1031493553 7:122419046-122419068 CAGACTCATGAGCCTGTAATAGG - Intronic
1037722606 8:21457822-21457844 CAGACCCATGTGACTGTAGTTGG - Intergenic
1042802213 8:72731862-72731884 CAGACTCACAAGACTGAAATTGG - Intronic
1042809997 8:72814016-72814038 CACACACAGGAGCCTGTCATGGG - Intronic
1043060792 8:75499947-75499969 CATATTCATGAGCTTGTATTAGG + Intronic
1043828357 8:84957183-84957205 CACACACATGAGCCTGTCAGGGG + Intergenic
1049370506 8:142262016-142262038 CAGCTTCATGAGCCTGTGAGAGG - Intronic
1052533190 9:29714513-29714535 CAAACTTATTAGCATGTAATAGG - Intergenic
1055358642 9:75464931-75464953 CAGACTCAACAGACTGCAATGGG - Intergenic
1058326786 9:103708450-103708472 CAGTCTCATCAACCTGAAATTGG + Intergenic
1060165235 9:121408051-121408073 CAGTCTCATGAGTCTATTATAGG - Intergenic
1189079953 X:37960126-37960148 CAGAGCTCTGAGCCTGTAATGGG + Intronic
1189124584 X:38432896-38432918 CAGACTCATGAGCAGCAAATAGG - Intronic
1190870160 X:54418131-54418153 CTGACTCATGAGACAGAAATAGG + Intergenic
1192683397 X:73278037-73278059 CACACCCATGAGACAGTAATGGG + Intergenic
1194936580 X:99957059-99957081 CAAACTAGTGAGCCTGCAATAGG + Intergenic
1199357268 X:146876381-146876403 CAGGCTCATATGCCTGTAAAAGG + Intergenic