ID: 1031493656

View in Genome Browser
Species Human (GRCh38)
Location 7:122420878-122420900
Sequence ATCTCTTCTTAAATGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 255}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031493656_1031493663 -7 Left 1031493656 7:122420878-122420900 CCTCCATACATTTAAGAAGAGAT 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1031493663 7:122420894-122420916 AAGAGATCCTACTGGGGAAGGGG No data
1031493656_1031493665 -3 Left 1031493656 7:122420878-122420900 CCTCCATACATTTAAGAAGAGAT 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1031493665 7:122420898-122420920 GATCCTACTGGGGAAGGGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 376
1031493656_1031493667 0 Left 1031493656 7:122420878-122420900 CCTCCATACATTTAAGAAGAGAT 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1031493667 7:122420901-122420923 CCTACTGGGGAAGGGGAGGGAGG 0: 1
1: 0
2: 6
3: 109
4: 1943
1031493656_1031493661 -9 Left 1031493656 7:122420878-122420900 CCTCCATACATTTAAGAAGAGAT 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1031493661 7:122420892-122420914 AGAAGAGATCCTACTGGGGAAGG 0: 1
1: 0
2: 4
3: 20
4: 266
1031493656_1031493664 -4 Left 1031493656 7:122420878-122420900 CCTCCATACATTTAAGAAGAGAT 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1031493664 7:122420897-122420919 AGATCCTACTGGGGAAGGGGAGG 0: 1
1: 0
2: 6
3: 28
4: 327
1031493656_1031493662 -8 Left 1031493656 7:122420878-122420900 CCTCCATACATTTAAGAAGAGAT 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1031493662 7:122420893-122420915 GAAGAGATCCTACTGGGGAAGGG 0: 1
1: 0
2: 3
3: 25
4: 210
1031493656_1031493668 4 Left 1031493656 7:122420878-122420900 CCTCCATACATTTAAGAAGAGAT 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG 0: 2
1: 4
2: 73
3: 556
4: 4173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031493656 Original CRISPR ATCTCTTCTTAAATGTATGG AGG (reversed) Intronic
900889077 1:5436263-5436285 ATTTCTTCTTAAAGCTAAGGTGG - Intergenic
906038994 1:42772366-42772388 AGCTTTTCTTAAAAGTAAGGTGG + Intronic
908362072 1:63378709-63378731 AACTCTTGTTAGATGTATGTTGG + Intronic
908884289 1:68770121-68770143 GTCACGTCTTAAATGGATGGTGG + Intergenic
909072370 1:71011747-71011769 AACTTTTCTTTAATGTAAGGAGG + Intronic
909132831 1:71760165-71760187 ATCTTTTATGAAATGTTTGGTGG + Intronic
911211327 1:95141458-95141480 ATCTAATCTTAAATGTGAGGAGG - Intronic
911817346 1:102369536-102369558 ATCTTTTCTAACATGGATGGTGG + Intergenic
915112168 1:153570949-153570971 ATCTCTTCTGAAAGTTATGGGGG - Intergenic
916646646 1:166793206-166793228 AACTCTTCTTAAATGTACCCTGG - Intergenic
917662073 1:177186656-177186678 ATCTCTTCCAAAATGCATGTGGG + Intronic
919572216 1:199263135-199263157 ATCTCTTCTTTAATAAATGTGGG - Intergenic
923442964 1:234039014-234039036 ATCTCTTCTTAAATGTCTATTGG - Intronic
924013316 1:239691253-239691275 ATCTCTTTTTATATGTCTGAAGG - Intronic
1063712802 10:8495928-8495950 ATCTCTACTCAAATGTGTTGTGG - Intergenic
1066147302 10:32574665-32574687 AGCTTTTCTTAAATGTTTTGTGG + Intronic
1066277882 10:33886776-33886798 ATCCCATCTTACATGGATGGTGG - Intergenic
1066644482 10:37592013-37592035 TCCTCTTCTTAAATGTGTGGTGG + Intergenic
1068061863 10:52078333-52078355 ATCATTTTTTAAATATATGGGGG + Intronic
1069144249 10:64869370-64869392 GTCTTTTCTGAAATGTATGCCGG + Intergenic
1069663151 10:70137199-70137221 ATCACGTCTTACATGGATGGCGG + Intergenic
1071151711 10:82643350-82643372 GTCACATCTTAAATGGATGGTGG - Intronic
1071927402 10:90425960-90425982 CTCTTTTCTTAAATATCTGGTGG + Intergenic
1072393245 10:95011056-95011078 TTTTTTTCTTAAATGTTTGGAGG + Intergenic
1072983197 10:100116983-100117005 CTCTCATCTCAAATGTATGAAGG - Intergenic
1074054374 10:109908962-109908984 TTCTCCTCTTTAAAGTATGGCGG + Intronic
1076026142 10:127115132-127115154 TTGTCATTTTAAATGTATGGTGG + Intronic
1078084684 11:8226589-8226611 ATGTGTTTTTAAATGTCTGGGGG - Intronic
1079807572 11:24953606-24953628 ATATCTACTTAAATGTTTTGAGG - Intronic
1079972367 11:27051411-27051433 AATTCTTCTTTAATGTTTGGTGG + Intronic
1080237204 11:30084724-30084746 ATTGCTTATTAAATGTATGTTGG + Intergenic
1081002687 11:37694658-37694680 ATCTCATCTTATGTGGATGGTGG - Intergenic
1081782120 11:45720428-45720450 CTCTCTTCTATAATGTCTGGGGG - Intergenic
1085010933 11:73141614-73141636 AACTCTTGTGAAATGTCTGGGGG + Intronic
1085249938 11:75136326-75136348 GTCTCGTCTTACATGGATGGTGG - Intronic
1085492786 11:76936151-76936173 GTCACTTCTTACATGGATGGTGG + Intronic
1086651824 11:89301166-89301188 ATCACATCTTACATGGATGGTGG + Intergenic
1086739459 11:90350199-90350221 ATCTTTACTGAACTGTATGGTGG + Intergenic
1086944736 11:92833720-92833742 ATCTCAAATAAAATGTATGGGGG + Intronic
1088403306 11:109444516-109444538 ATCTATTCTTAGCTGTACGGTGG + Intergenic
1089595889 11:119579845-119579867 AATTCTGCTTAAATGTAGGGCGG + Intergenic
1089851940 11:121505812-121505834 AGTTCTTTTTAAATGTATTGGGG + Intronic
1089950988 11:122526027-122526049 ATCACTTCTTAAAATTGTGGAGG + Intergenic
1091044043 11:132310114-132310136 TTGGCTTCTGAAATGTATGGTGG - Exonic
1092625902 12:10328238-10328260 ATTTCTCCTTAAATATTTGGTGG + Intergenic
1093563520 12:20573629-20573651 ATCACATCTTAAATATATGTTGG - Intronic
1093609007 12:21131622-21131644 ATGTCTTCTTAACTGGATGAAGG + Intronic
1093785358 12:23186231-23186253 ATCTTTTCTTAAATTTATGGAGG + Intergenic
1094112811 12:26879544-26879566 ATCTCCTCTTTTATGTATGGCGG + Intergenic
1094239363 12:28203608-28203630 ATCTGTTCCTAAATTTAGGGAGG + Intronic
1096354199 12:50926376-50926398 ACCTCTTCTAATGTGTATGGTGG - Intronic
1097970120 12:65624529-65624551 TTCTCTTCTTAAGTGTCTAGAGG - Intergenic
1098143471 12:67474475-67474497 ATCACTTGGTAAATGTATGTAGG - Intergenic
1099234268 12:80063889-80063911 ATTTATTTTTATATGTATGGAGG + Intergenic
1099869282 12:88326535-88326557 ATTTCTTGTTAAATGTATTAAGG - Intergenic
1099988335 12:89695191-89695213 ATCTCTTCTATAATGAATAGGGG - Intronic
1100035393 12:90244875-90244897 TTCTCTCCATAAATGAATGGGGG - Intergenic
1101678871 12:106945105-106945127 ATCTCTTCTTCAATTTTTGTTGG - Intergenic
1102764983 12:115424667-115424689 ATCTCATCTTAAAAGTAAAGAGG + Intergenic
1105703291 13:22949730-22949752 ACCTCTTCTGAAATGGATGCTGG + Intergenic
1105855939 13:24371897-24371919 ACCTCTTCTGAAATGAATGCTGG + Intergenic
1106855250 13:33845013-33845035 ATTTCTCCTTAAATGTTTGAAGG + Intronic
1107101914 13:36602326-36602348 ATCTCTTCATAAATTTGTGCCGG + Intergenic
1107745198 13:43497805-43497827 ATTTCTTCTTAAATGTTTGAAGG + Intronic
1108332285 13:49400305-49400327 ATATCTTTTTAAAGGCATGGAGG - Intronic
1108790829 13:53967260-53967282 GTCACATCTTAAATGGATGGTGG - Intergenic
1109205658 13:59479951-59479973 ATCTCTTCTTAAATGTGCTTGGG + Intergenic
1111082833 13:83335217-83335239 TTCTCTCCATAAATGTCTGGGGG + Intergenic
1111374502 13:87361043-87361065 ATCTCTTCTTAAATACCTTGGGG + Intergenic
1111502891 13:89146939-89146961 AAATCCTCTTAAATGTATTGGGG + Intergenic
1112308043 13:98293117-98293139 ATCTTTTCTTAACTCAATGGTGG + Intronic
1112747544 13:102543819-102543841 AACTTTTCTTAAATTTATTGAGG - Intergenic
1112964324 13:105168704-105168726 TTATTTTCTTAAAAGTATGGAGG + Intergenic
1113292814 13:108924919-108924941 ATCTCTTCTTAAATATATTTTGG + Intronic
1113530613 13:111022544-111022566 ATGTCTTCTCACATGTATGTGGG + Intergenic
1114842254 14:26278417-26278439 ATCTTTTCTTAAATATTTGTTGG + Intergenic
1116426257 14:44795686-44795708 ATTTCTTCTAAAATGGATGGAGG - Intergenic
1116466664 14:45241165-45241187 ATTAATTCTTAAATGTATGATGG - Intronic
1116479112 14:45376465-45376487 ATCTCTATTTAAATGAAAGGAGG + Intergenic
1118535778 14:66762766-66762788 GACTCTTCTCAAAAGTATGGTGG + Intronic
1119162655 14:72465840-72465862 CTCTCTTCTTATATGTATCCTGG - Intronic
1119369814 14:74129973-74129995 ATCACGTCTTACATGGATGGCGG + Intronic
1120895330 14:89525684-89525706 ATTTTTCCTTAAATGTTTGGTGG - Intronic
1121262259 14:92575023-92575045 TTCTCCTCTTAAACCTATGGGGG - Intronic
1122506717 14:102236303-102236325 ATCTCTTTTTAAATTGATAGCGG + Intronic
1122844835 14:104487318-104487340 ACCTCTTCTGAAATGGATGCTGG + Intronic
1124066421 15:26348017-26348039 ATCACATCTTACATGGATGGCGG - Intergenic
1124465783 15:29938770-29938792 AACTCTACTTAAATTTATGATGG - Intronic
1128469240 15:67938064-67938086 ATCTTTTCGTAAATGTCTGTAGG + Intergenic
1128989235 15:72244950-72244972 GTCACATCTTAAATGGATGGTGG + Intronic
1129572984 15:76709625-76709647 ATTTCTTTCTAAATGTTTGGGGG - Intronic
1131245697 15:90790717-90790739 ATCTCTCCCTAAATCTGTGGAGG + Exonic
1132192082 15:99873862-99873884 ATCTCCTGTTAAATGTTTGGAGG + Intergenic
1133518436 16:6532435-6532457 CTCATTTCTTGAATGTATGGAGG + Intronic
1135011495 16:18883963-18883985 ATTTCTGCTTAAATGTCAGGAGG + Intronic
1135318397 16:21471547-21471569 ATTTCTGCTTAAATGTCAGGAGG + Intergenic
1135371290 16:21903342-21903364 ATTTCTGCTTAAATGTCAGGAGG + Intergenic
1135440497 16:22467373-22467395 ATTTCTGCTTAAATGTCAGGAGG - Intergenic
1136328599 16:29552978-29553000 ATTTCTGCTTAAATGTCAGGAGG + Intergenic
1136443286 16:30292992-30293014 ATTTCTGCTTAAATGTCAGGAGG + Intergenic
1136955847 16:34785118-34785140 ATCTTTTCTTCAATATCTGGTGG - Intergenic
1137220438 16:46444361-46444383 ATTTTTTCTTCAATATATGGTGG + Intergenic
1138856571 16:60700732-60700754 ATGGCTTCTTAAATAAATGGTGG - Intergenic
1139890011 16:70245412-70245434 ATTTCTGCTTAAATGTCAGGAGG + Intergenic
1139894376 16:70276451-70276473 ATCACTTCTTGAGAGTATGGAGG - Intronic
1144262844 17:13539888-13539910 ATCTCATCTTACATGGTTGGTGG - Intronic
1147228907 17:39002871-39002893 ATCTCTACTAAAATGTAAGGAGG - Intergenic
1147268180 17:39247468-39247490 ATCTCTTGATAAAAGTCTGGGGG - Intergenic
1147378601 17:40038403-40038425 CTTTCTTCTTAAATCTTTGGAGG - Intronic
1147672987 17:42187524-42187546 ATGTGTTCTTCAATGCATGGCGG - Intergenic
1154278992 18:12983604-12983626 ATGTCTTCTGAAATGGATGTAGG - Intronic
1155139395 18:23030353-23030375 ATGTATTTTTAAATGTATGTAGG + Intergenic
1155306123 18:24480352-24480374 GTCACTTCTTACATGGATGGTGG + Intergenic
1155729941 18:29143742-29143764 TTCTCTTCTAAAAGGTATGCAGG + Intergenic
1155731085 18:29159315-29159337 ATCTCTCCTTAAATTTATCCAGG - Intergenic
1156755652 18:40521509-40521531 TTCACTTCCTAAATGTATGCTGG + Intergenic
1156991454 18:43413765-43413787 ATATATTCTTGAGTGTATGGGGG + Intergenic
1159225774 18:65533603-65533625 ATCTCTCCATAAATGTGGGGGGG + Intergenic
1159437494 18:68438094-68438116 ATCACATCTTACATGGATGGTGG + Intergenic
1159650524 18:70972162-70972184 GTCTCATCTTACATGGATGGTGG + Intergenic
1164031148 19:21406597-21406619 ATCATTTCTAAAATGTATGAGGG + Intronic
1164818030 19:31221642-31221664 TTCTCTTCTTCCATGTTTGGTGG + Intergenic
1168558208 19:57361488-57361510 ATCGCTTATTAACTGTTTGGAGG - Intergenic
925526883 2:4813156-4813178 ATCACATCTTACATGGATGGTGG + Intergenic
926973714 2:18492281-18492303 ATTTCTTCTTAAATGCTTGGGGG - Intergenic
930254860 2:49078221-49078243 GTCACATCTTAAATGGATGGTGG + Intronic
930743016 2:54852209-54852231 ATCTCTTATAAAAGTTATGGTGG - Intronic
934967209 2:98732844-98732866 GTCACTTCTTACATGGATGGTGG - Intergenic
936738985 2:115481167-115481189 ATCTCTTCTTGAATTACTGGAGG - Intronic
937047639 2:118860229-118860251 ATCTCTTCTTTGATGTATTTTGG - Intergenic
939071637 2:137551398-137551420 ATCTCTTGTCAAATGAATGTAGG - Intronic
939694804 2:145311338-145311360 ATCACATCTTACATGTATGGTGG + Intergenic
942472908 2:176281163-176281185 ATGCCTTTTTAAATGTAAGGTGG + Intronic
943202854 2:184851574-184851596 ATCTCTTCATGCATCTATGGAGG + Intronic
943486066 2:188484074-188484096 GTCTCTTCTAAAAAGCATGGTGG - Intronic
943492959 2:188580229-188580251 ATCTCTACATAAATAGATGGAGG + Intronic
944005953 2:194905829-194905851 ATCTCTTCCCAAATATATAGTGG - Intergenic
944476556 2:200112465-200112487 ATCTCTCCTCACATTTATGGGGG - Intergenic
945129742 2:206557838-206557860 GGCTTTTCTTAAATATATGGTGG + Intronic
946505918 2:220300671-220300693 CTGTCTTTTTAAATATATGGAGG + Intergenic
948271252 2:236674780-236674802 ATCTATTCTTTAAAGTCTGGGGG - Intergenic
1169471950 20:5894033-5894055 ATCTCTTCTTAACATGATGGTGG + Intergenic
1169999642 20:11601027-11601049 TTCTCTTCAAAAATGCATGGGGG + Intergenic
1170587711 20:17747681-17747703 ACCTCATCTTGAATGTATGCAGG + Intergenic
1176307543 21:5131762-5131784 GTCTCTTCCTAAGTGTTTGGTGG - Intronic
1177257400 21:18683254-18683276 TTCTCTTCTAAAATTTATAGGGG + Intergenic
1177258099 21:18692237-18692259 ATCACGTCTTACATGGATGGTGG + Intergenic
1177554407 21:22671293-22671315 GTCACATCTTACATGTATGGTGG - Intergenic
1177614550 21:23500118-23500140 GTCACATCTTATATGTATGGCGG + Intergenic
1179849517 21:44130268-44130290 GTCTCTTCCTAAGTGTTTGGTGG + Intronic
1180257185 21:46638736-46638758 ATCTCTTCTATAATGGAGGGTGG - Intronic
1181302446 22:21890928-21890950 ATTTCTTGTTAAAGGCATGGAGG + Intergenic
1181710535 22:24683793-24683815 ATCACTTCTAAAATATGTGGAGG - Intergenic
1183497789 22:38159212-38159234 ATTTCCTTTTTAATGTATGGAGG - Intronic
1184311802 22:43650382-43650404 GTCTCATCTTACATGGATGGCGG - Intronic
1185145757 22:49135254-49135276 ATCTATTTTTAATTGTATCGGGG + Intergenic
951404955 3:22284537-22284559 ATCAATTCTAAATTGTATGGTGG + Intronic
952036820 3:29212728-29212750 GTCACATCTTAAATGGATGGTGG - Intergenic
952651936 3:35737627-35737649 CCCTTTTTTTAAATGTATGGAGG + Intronic
952660245 3:35837419-35837441 AACTCTTTTTAAATCTATGAAGG - Intergenic
952950991 3:38525315-38525337 ATCTTTTCTGACATGGATGGTGG + Exonic
955826704 3:62954896-62954918 GGCTGTTCTTAAATGTAAGGAGG + Intergenic
956375275 3:68607811-68607833 GTCACTTCTTACATGGATGGTGG + Intergenic
958586987 3:96100125-96100147 TTCACTTCTTAGGTGTATGGAGG + Intergenic
958940854 3:100312679-100312701 ATTTCTTTTTAAATGTTTGTAGG - Intronic
959007753 3:101039755-101039777 ATTTCTTCTTAAAACTATGTTGG + Intergenic
959815532 3:110669791-110669813 GTCACATCTTAAATGGATGGTGG - Intergenic
960504207 3:118473122-118473144 CTCTCTTGTTAAACTTATGGTGG - Intergenic
961068428 3:123897018-123897040 ATCTCCTCTTAAATGCAGGTGGG - Intergenic
962661412 3:137604277-137604299 ATCTATTCCTAGATGTAAGGGGG - Intergenic
963324350 3:143845135-143845157 ATCTCTTATTAAAGAGATGGAGG + Intronic
963441300 3:145343739-145343761 ATCTCTTATTAAATGTTAGCTGG - Intergenic
964572537 3:158124500-158124522 ATTTCTTTTTAAATGTTTGGTGG + Intronic
966931046 3:184675798-184675820 ATTTCTTCTCAAATGCATGGGGG + Intronic
970344158 4:15136958-15136980 GTCTCATCTTACATGGATGGCGG + Intergenic
970579780 4:17464669-17464691 GTCACATCTTAAATGGATGGTGG - Intronic
970788644 4:19830126-19830148 ATCACATCTTAAATGGTTGGTGG + Intergenic
972448070 4:39166339-39166361 TCCTCTTCTTAAATGTTTGATGG - Intergenic
973054149 4:45633281-45633303 AGTTTTTCTTAAATGTTTGGTGG - Intergenic
973111038 4:46398182-46398204 ATCTGTTCTTACATCTATGCTGG - Intronic
973193936 4:47418208-47418230 ATCTCTTATTATATGTATGTTGG - Intronic
973217770 4:47690035-47690057 ATCTCTTCTTAAGTATTTGTTGG - Intronic
976635528 4:87283349-87283371 ATCACGTCTTACATGGATGGTGG - Intergenic
976635813 4:87285463-87285485 ATCACATCTTACATGGATGGCGG - Intergenic
977424171 4:96845157-96845179 ATCTCATCTCAAAGATATGGAGG + Intergenic
979312918 4:119225352-119225374 ATTTCTTCTTAAAAGGCTGGTGG - Intronic
979482233 4:121233043-121233065 ATCACTTATTATATGTATAGAGG - Intergenic
980207280 4:129736210-129736232 ATCTCTTCATGAATATATGTAGG - Intergenic
980432737 4:132725812-132725834 ATCACATCTTAAGTGGATGGCGG + Intergenic
980494849 4:133577361-133577383 ATCACATCTTATATGGATGGCGG - Intergenic
980718804 4:136665327-136665349 GTTTCTTTTTAAATGTTTGGTGG - Intergenic
981692089 4:147520722-147520744 ACCTCTTCTAAATTGTATGTAGG - Intronic
981973085 4:150689613-150689635 ATTTCCTCTTAAATGTTTGGTGG - Intronic
982575735 4:157107567-157107589 AACTCTTCTTAATTCTATGAAGG + Intronic
982901960 4:161017216-161017238 ATCACATCTTACATGGATGGTGG - Intergenic
983175471 4:164583342-164583364 CTATTTTCTTAAATGTATGGAGG + Intergenic
983856714 4:172655872-172655894 TTCTCTTCTTTAATGAAAGGAGG - Intronic
984313492 4:178095635-178095657 ATTTTTTCTTAAATGTTTGGTGG - Intergenic
984519235 4:180781565-180781587 ACCTCTTTTTAAATCTATTGAGG + Intergenic
986197849 5:5554404-5554426 ATCACATCTTACATGGATGGTGG + Intergenic
986426772 5:7639611-7639633 ATCTTTTCTAAATTGTATGCAGG + Intronic
987439889 5:17942736-17942758 GTCACTTCTTACATGGATGGTGG - Intergenic
987943797 5:24577473-24577495 ATATCTTCTTGCATGTATGCAGG - Intronic
990041786 5:51385771-51385793 ATCACTTTTTAAATGTCCGGTGG + Intronic
990232454 5:53728051-53728073 ACCTCTGATGAAATGTATGGTGG - Intergenic
991116600 5:62962610-62962632 GTCTCATCTTACATGGATGGTGG + Intergenic
992105304 5:73445105-73445127 AACCCTTGTTAAATGTTTGGAGG - Intronic
994214737 5:97125069-97125091 TTCTCTTCTTAAATCTTTGCAGG - Intronic
995147917 5:108807172-108807194 ATCACATCTTACATGGATGGCGG - Intronic
997093117 5:130879484-130879506 ATCACATCTTAGATGGATGGTGG - Intergenic
998973071 5:147613783-147613805 AACTCTTCTTTAAAGTAAGGGGG + Intronic
999633422 5:153595464-153595486 ATCACTTCTTAAATGTAGACTGG - Intronic
1000105401 5:158054340-158054362 GTCTCTGCTTAAATGCATGTTGG + Intergenic
1001869970 5:175144664-175144686 TTTCCTTCTTAAATGTTTGGTGG - Intergenic
1005878079 6:30030453-30030475 GTCTCTCTTTAAATGTTTGGTGG + Intergenic
1007904079 6:45441369-45441391 ATCATTTATTAACTGTATGGAGG + Intronic
1008258590 6:49336311-49336333 ATTTCTTCATAAATGTATTTTGG - Intergenic
1008815365 6:55558322-55558344 ATCACTTTTTAAAAGTAAGGTGG + Intronic
1008899917 6:56600240-56600262 AAAACATCTTAAATGTATGGTGG + Intronic
1009584213 6:65576035-65576057 ATCTCCTCTTTAATTTTTGGAGG - Intronic
1009677553 6:66845575-66845597 AACTGTTTTTAAATGCATGGAGG - Intergenic
1009844580 6:69120186-69120208 ATCGCTTCTTTAAAGTCTGGAGG + Intronic
1010419150 6:75652197-75652219 ATGGATTCTTAAATTTATGGAGG + Intronic
1011674576 6:89719811-89719833 ATATCTACATAAATGTTTGGAGG - Intronic
1012308511 6:97690548-97690570 ATATCTTCTTAAATAGATCGTGG + Intergenic
1013450718 6:110277877-110277899 ATTTTTTCTTGAATGTTTGGGGG - Intronic
1013847903 6:114476772-114476794 ATCTCTTGATAAATATTTGGTGG - Intergenic
1015363600 6:132371582-132371604 ATCTCTGCTAAAATGTCTTGAGG + Intronic
1016075798 6:139794421-139794443 ATCTCATCTTATGTGGATGGTGG + Intergenic
1016565175 6:145443889-145443911 GTCACTTCTTACATGAATGGAGG - Intergenic
1016723989 6:147338616-147338638 ATGTCTACCTAAATTTATGGAGG - Intronic
1018595228 6:165472074-165472096 TTCTCCTCTTTAATGTTTGGTGG + Intronic
1018748489 6:166781133-166781155 TTCTCTGCTTAAATTTATGAAGG + Intronic
1019878176 7:3834500-3834522 ATCTTTTCTTTCACGTATGGAGG + Intronic
1020490673 7:8780081-8780103 ATCTCTCCTTAAATTCTTGGGGG - Intergenic
1020744105 7:12059211-12059233 TGATCTTCTTAAATGTATTGAGG - Intergenic
1021191959 7:17631164-17631186 ATCTCTTTTTGAATATGTGGTGG + Intergenic
1023721399 7:43099063-43099085 ATCTCTTCATAAAGGTAAGGAGG + Intergenic
1024478117 7:49835395-49835417 AAATTTTCTTAAATGCATGGTGG + Intronic
1024726139 7:52197723-52197745 ATCTCTTCTTTAATTTCTGTTGG + Intergenic
1024788261 7:52932978-52933000 TTATCTTCTTAAATATTTGGTGG - Intergenic
1025490099 7:61105966-61105988 ATCTCTTAGTGAATTTATGGTGG + Intergenic
1027835328 7:83234523-83234545 ACCCCTTCTTAAAAATATGGGGG - Intergenic
1031493656 7:122420878-122420900 ATCTCTTCTTAAATGTATGGAGG - Intronic
1031700198 7:124915609-124915631 ATCTCTTCTTTAACTTATCGTGG - Exonic
1032331617 7:130985996-130986018 ATATGTTCTTGAATGAATGGTGG + Intergenic
1033006708 7:137572950-137572972 ATCTCTGCTTAAGTGAATGCCGG + Intronic
1041993582 8:64025793-64025815 ATTTCTTCTGAAACTTATGGGGG - Intergenic
1042778415 8:72461784-72461806 AATTTTTCTTGAATGTATGGTGG + Intergenic
1045090526 8:98738572-98738594 ATATGTTCTTAATTATATGGTGG - Intronic
1045421393 8:102019579-102019601 CTTGCTACTTAAATGTATGGTGG - Intronic
1045716806 8:105056435-105056457 ATCACATCTTACATGGATGGAGG - Intronic
1045719396 8:105090275-105090297 ATCTCTTCCTAAATGGCTGCAGG - Intronic
1046336456 8:112794940-112794962 ATCTCTTCTTCAATTAATGCTGG - Intronic
1046807212 8:118492654-118492676 TTCTCTTCTTAAATAACTGGGGG - Intronic
1047285244 8:123482141-123482163 ATTTATTCTTGAATTTATGGTGG - Intergenic
1048189152 8:132272604-132272626 ATCACATCTTACATGGATGGGGG + Intronic
1048599444 8:135904200-135904222 ATCTGCTCTTAGATGTATGTTGG + Intergenic
1050143965 9:2545915-2545937 ATCTGTTCTTCTCTGTATGGTGG + Intergenic
1050898805 9:10918285-10918307 TTCTGTGCTTAATTGTATGGAGG + Intergenic
1052005083 9:23337611-23337633 ATTTTTTCTTATAGGTATGGAGG + Intergenic
1052215039 9:25956422-25956444 ATCTCTTTTTAAATTTCTGTGGG + Intergenic
1054905552 9:70411709-70411731 ACCTCATCTTAAAAGTATCGAGG + Intronic
1056255230 9:84792196-84792218 CTCTCTTCTTTAATGTATTAAGG - Intronic
1058376176 9:104324582-104324604 TTCTCTTATTAAATGTAAAGTGG + Intergenic
1061797506 9:133096245-133096267 AACTCTCATTAAATGTATGTTGG + Intergenic
1186993881 X:15098991-15099013 ATCAAATCTGAAATGTATGGTGG + Intergenic
1189075551 X:37910313-37910335 ATCTCTTCTTATAAGGATGCTGG + Intronic
1189153960 X:38736199-38736221 AACTCTTATTAGATGTATGTTGG - Intergenic
1189671250 X:43411899-43411921 ATTTCTTCTTAAATGTTTAGAGG + Intergenic
1191732352 X:64350906-64350928 ATCTGTTGTTAAATGTTTGGGGG - Intronic
1194157410 X:90408495-90408517 ATTCTTTCTTAAATGTTTGGTGG + Intergenic
1197002960 X:121460756-121460778 ATCACATCTTAAGTGAATGGCGG - Intergenic
1198576987 X:138021280-138021302 ATCTATTCTAACATGTCTGGGGG - Intergenic
1199813918 X:151379868-151379890 ATTTCTTCTTGAATGAATGTTGG - Intergenic
1200503742 Y:3985488-3985510 ATTCTTTCTTAAATGTTTGGTGG + Intergenic
1201463322 Y:14252685-14252707 ATGACTTCTTAAAGATATGGAGG + Intergenic