ID: 1031493657

View in Genome Browser
Species Human (GRCh38)
Location 7:122420881-122420903
Sequence AGGATCTCTTCTTAAATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 192}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031493657_1031493665 -6 Left 1031493657 7:122420881-122420903 CCATACATTTAAGAAGAGATCCT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1031493665 7:122420898-122420920 GATCCTACTGGGGAAGGGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 376
1031493657_1031493667 -3 Left 1031493657 7:122420881-122420903 CCATACATTTAAGAAGAGATCCT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1031493667 7:122420901-122420923 CCTACTGGGGAAGGGGAGGGAGG 0: 1
1: 0
2: 6
3: 109
4: 1943
1031493657_1031493663 -10 Left 1031493657 7:122420881-122420903 CCATACATTTAAGAAGAGATCCT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1031493663 7:122420894-122420916 AAGAGATCCTACTGGGGAAGGGG No data
1031493657_1031493668 1 Left 1031493657 7:122420881-122420903 CCATACATTTAAGAAGAGATCCT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG 0: 2
1: 4
2: 73
3: 556
4: 4173
1031493657_1031493664 -7 Left 1031493657 7:122420881-122420903 CCATACATTTAAGAAGAGATCCT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1031493664 7:122420897-122420919 AGATCCTACTGGGGAAGGGGAGG 0: 1
1: 0
2: 6
3: 28
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031493657 Original CRISPR AGGATCTCTTCTTAAATGTA TGG (reversed) Intronic
905124741 1:35708459-35708481 AGAATCTCTTCTCAAATCTATGG + Intergenic
906018245 1:42602705-42602727 ATAATCTATTCTTAAATGTTTGG - Intronic
909734081 1:78934304-78934326 AGGATCTCTTATTCAATAAATGG + Intronic
911211328 1:95141461-95141483 AGAATCTAATCTTAAATGTGAGG - Intronic
912264732 1:108145652-108145674 AGGATTCCTTATTTAATGTATGG - Intronic
912608036 1:111012900-111012922 AGGATCTCTTATTCAATAAATGG + Intergenic
915925782 1:160018389-160018411 AGAATCCCTTCTTAATTGTCTGG + Intergenic
916789831 1:168115603-168115625 AGGATGTCCTCATAAATGAAGGG - Intronic
917021202 1:170590234-170590256 AAAATCTCTCTTTAAATGTATGG - Intergenic
917066140 1:171095699-171095721 AGCATCTTTTCTTAAAAATATGG + Intronic
917103375 1:171468093-171468115 AGGATTTCTTCTTAATATTATGG - Intergenic
917285589 1:173418790-173418812 GGGATCTCTGTTTACATGTAAGG - Intergenic
918808652 1:189085801-189085823 AATTTCTCTTCTTAAATGTAGGG - Intergenic
919260587 1:195188901-195188923 AGAATCTCAGCTGAAATGTATGG + Intergenic
921028350 1:211311947-211311969 AATATCTCTTCTTAAGTTTAAGG + Intronic
922682448 1:227611904-227611926 AGCATCTCTTGTCAAATGGAAGG + Intronic
1063695771 10:8333482-8333504 GGGATCTCTTTTTAAATATTAGG + Intergenic
1065612584 10:27487002-27487024 ATTAACTCTTCTTAAATGTTTGG + Intergenic
1067688663 10:48485346-48485368 TGGATTTCTTCTTTAATTTATGG + Intronic
1070106507 10:73437537-73437559 AGGTTTTCTTCTTAAATCTCTGG + Exonic
1071365448 10:84895241-84895263 ATGGTCTCTTCTTAGATGAATGG + Intergenic
1071772683 10:88747177-88747199 ACCAGCTCTTCTTACATGTATGG - Intronic
1071779839 10:88831856-88831878 AGCATTTCTTCTTAAAAGGAAGG + Exonic
1072337670 10:94413465-94413487 AGGATTTCTTCTTAAAGGCACGG - Intronic
1078298832 11:10104202-10104224 GGTATCTCTTCTTAAATTTGAGG + Intronic
1078820841 11:14880090-14880112 AGGGTCTATCCTTACATGTAGGG - Intronic
1082834804 11:57643908-57643930 AGGAACTCAGCTTAGATGTAAGG - Intergenic
1083093862 11:60229227-60229249 AGGTTCAATTTTTAAATGTATGG - Intronic
1084344589 11:68537361-68537383 AGCATCACTTCTTAATAGTATGG + Intronic
1085774490 11:79353025-79353047 AAGATCACTTCTTAAATGTTGGG + Intronic
1086058799 11:82679626-82679648 AGGCTCTGTTCTTAAATTTGGGG - Intergenic
1087792067 11:102416609-102416631 AGAATCTCTTCTTAATTTTTTGG - Intronic
1088403305 11:109444513-109444535 AGCATCTATTCTTAGCTGTACGG + Intergenic
1089032947 11:115352344-115352366 AGGATTGCTTCTTAAATGCAGGG - Intronic
1089814334 11:121158902-121158924 AGATGCTCTTCTTAAATGGAAGG - Intronic
1090058188 11:123441267-123441289 AGGATCTCTTATGAAAGGTTTGG - Intergenic
1090800907 11:130171334-130171356 AAGATCTCTTATTGAAGGTATGG + Intronic
1091604702 12:1940329-1940351 AGTATGTTTCCTTAAATGTATGG - Intergenic
1092357395 12:7807959-7807981 AGGATCTCTTATAAACTGTGAGG - Intergenic
1093204350 12:16229199-16229221 CGGATTTCTTCTTAACTGTGTGG - Intronic
1093866399 12:24232323-24232345 TAGAACTCTTGTTAAATGTAAGG - Intergenic
1094088182 12:26617477-26617499 AGGATCTGTTCATAAATGTTTGG - Intronic
1095699599 12:45177288-45177310 TGGGTCTCTTCTTGATTGTATGG - Intergenic
1095823565 12:46507669-46507691 AGGGTTTCTTCCTGAATGTATGG + Intergenic
1095844034 12:46726920-46726942 CTGATCTCTTATTAGATGTATGG - Intergenic
1099056101 12:77842787-77842809 ACAATCTCTTTTTAAATGCAAGG + Intronic
1099400887 12:82202793-82202815 AGGATACCTTCTTCAATGAATGG - Intergenic
1100233804 12:92637180-92637202 AGCATCACTCTTTAAATGTAGGG - Intergenic
1100773091 12:97945305-97945327 ATGATTTCCTCTTAAATGCATGG - Intergenic
1101773553 12:107773819-107773841 AAGCTCTCATCATAAATGTAGGG + Intergenic
1102271544 12:111540652-111540674 GGCATGTCTTTTTAAATGTATGG + Intronic
1102623974 12:114219658-114219680 AGCAGCTCTTCTTAAATGCCAGG + Intergenic
1102629704 12:114267092-114267114 AGGATCTATTTATGAATGTATGG + Intergenic
1105647062 13:22332371-22332393 AGCATGTGTTTTTAAATGTAAGG + Intergenic
1106962409 13:35014593-35014615 AGAATCTCTACTTAAAAGCAGGG + Intronic
1107060406 13:36154146-36154168 ACTATTTCTTCTTTAATGTAAGG - Intergenic
1109658877 13:65432234-65432256 AGTATCTCTTCATAAAAGAATGG - Intergenic
1110305878 13:73985995-73986017 AGGATGTCTTAGTAAGTGTATGG + Intronic
1110651898 13:77951701-77951723 AGAATCACTTCTAAAATTTAGGG - Intergenic
1115450387 14:33540992-33541014 AGGATTTCTTCTTTACTTTATGG + Intronic
1116267019 14:42705398-42705420 ATTTTCTCTTCTTTAATGTATGG - Intergenic
1116426258 14:44795689-44795711 AGAATTTCTTCTAAAATGGATGG - Intergenic
1116911094 14:50465370-50465392 AGCTTCTTTTATTAAATGTATGG + Intronic
1120313539 14:82862146-82862168 ATGATGTCTTGTCAAATGTATGG + Intergenic
1121128009 14:91420318-91420340 AGCCTCTCTTCTGAAAAGTAAGG + Intergenic
1123715218 15:23023523-23023545 AGAAGCTCTTCATATATGTATGG + Intronic
1123911116 15:24967829-24967851 GGAATATCTTCTTAAATGTAAGG + Intronic
1124575059 15:30900742-30900764 AGGATTTTTTTTTAAGTGTAAGG + Intergenic
1127514666 15:59681245-59681267 AGGATGTCTTCTGACAAGTACGG + Intronic
1130424191 15:83778433-83778455 AGAATCTCTTCTTGCTTGTAAGG - Intronic
1131972761 15:97908652-97908674 AGGATCTTTTGGTAAATGGAAGG - Intergenic
1132265418 15:100466142-100466164 AGAATGAGTTCTTAAATGTAGGG + Intronic
1140954804 16:79852784-79852806 AGGATCTCTTATTAAGTAAATGG - Intergenic
1149055571 17:52359416-52359438 ATGCTTTCTTCTTAACTGTAAGG - Intergenic
1151110690 17:71674430-71674452 AGGGTCTCTTCTTTATTTTAAGG + Intergenic
1151857007 17:76728732-76728754 TGCATTTCTTCCTAAATGTAGGG + Intronic
1152991822 18:370660-370682 AGTATCTCTTCTTAATGGAAGGG - Intronic
1153675555 18:7453295-7453317 AGGAGCTTTACTAAAATGTACGG - Intergenic
1155615672 18:27718437-27718459 AACACCTCTTGTTAAATGTAGGG + Intergenic
1156002009 18:32395618-32395640 AGAATGACTTCTTGAATGTAGGG - Intronic
1159521340 18:69528638-69528660 AGGCTTTCTGTTTAAATGTAAGG + Intronic
1165563789 19:36705546-36705568 ATGATGTCTTCCTAAATTTATGG + Intronic
1165759977 19:38315466-38315488 AGGTTCGCTTCTTAAATGAGCGG + Intronic
1167463626 19:49639008-49639030 AGGATGTCTTTTTAAATCTCGGG + Intronic
926521487 2:13921354-13921376 AGAATCTCTACTAAAATATATGG - Intergenic
927395290 2:22643389-22643411 AGGTTTTCTTCTTATATATATGG + Intergenic
928227148 2:29460279-29460301 CTGCTTTCTTCTTAAATGTAAGG + Intronic
928731936 2:34241566-34241588 AAGATCTCTTCTTAAGTGGCTGG - Intergenic
930094720 2:47558443-47558465 GGGTTCTCTTCTAAAATGGAAGG - Intronic
930372821 2:50525766-50525788 AGGCTCTCTTCTTCCATTTAAGG + Intronic
933768246 2:85725738-85725760 AGGAACACTTCAAAAATGTATGG + Intergenic
933871630 2:86571651-86571673 ATGATTTCTTCTTATATGTAAGG - Intronic
935007862 2:99098860-99098882 TGGATCTCTTCTTTAAGGGAAGG - Intronic
936167478 2:110135757-110135779 AAGATCTCTTTTTAAATCTTTGG - Intronic
936963848 2:118105993-118106015 AGCATCTATTCACAAATGTATGG - Intronic
940042393 2:149374129-149374151 AGCATCTTTTCTTAAACTTATGG + Intronic
940411188 2:153365143-153365165 AGGATTTCTTATTTAATGAATGG + Intergenic
940481463 2:154237240-154237262 AAGGTCTCATCTGAAATGTATGG - Intronic
942076460 2:172360736-172360758 AGGATCTTTTCTTGAGTGGAAGG + Intergenic
942472907 2:176281160-176281182 ATGATGCCTTTTTAAATGTAAGG + Intronic
946545073 2:220731675-220731697 AGGATATTTTATTAAATGAAGGG + Intergenic
1169692581 20:8348438-8348460 GGGATCTTTTCTTAAAGGTGGGG + Intronic
1169695239 20:8380204-8380226 AGGATCTCCTATTAAATAAATGG - Intronic
1169836192 20:9882113-9882135 AGGATATCCTCTTAAATAAATGG - Intergenic
1169887660 20:10418632-10418654 AGAATCTCCTCTAAAATGTTAGG - Intronic
1170259001 20:14381701-14381723 AGAATCTGTTCTTAGATGAAGGG - Intronic
1172580582 20:36044249-36044271 AGGACCTCTTCTGTAATTTAAGG - Intergenic
1172695648 20:36820975-36820997 AGGCTTTCTTCTTTAATTTATGG + Intronic
1172821327 20:37737416-37737438 ATGATCTCTTTTCAAATGTGAGG - Exonic
1173057796 20:39633046-39633068 ATTATCTGTTCTTAGATGTATGG - Intergenic
1182000355 22:26914813-26914835 AGGAACTGTTCATAAATCTATGG + Intergenic
1182846395 22:33434604-33434626 AGGATCTTTTATTGAATTTAGGG + Intronic
949311662 3:2706375-2706397 AGGATGTCTTGTTAACTTTAAGG + Intronic
949863767 3:8530276-8530298 AGCATCTCTTCTGAAAAATAAGG - Intronic
950727402 3:14925686-14925708 AGGATCCCTCCCTAAATGTGAGG + Intronic
953812544 3:46126342-46126364 AGGATTTATCCTTGAATGTAAGG + Intergenic
955425517 3:58785511-58785533 ATGATCTTTTGTTACATGTATGG - Intronic
956320158 3:67987531-67987553 AGGATCTTTTCATACAGGTAAGG + Intergenic
957113051 3:75991472-75991494 AAGATCACTTCTTACATGGATGG - Intronic
958921159 3:100107119-100107141 AGGATTTTTTTTTAACTGTATGG - Intronic
960093500 3:113665877-113665899 AAGATATATTTTTAAATGTAAGG - Intronic
966955962 3:184879318-184879340 CTAATCTCTTCTTCAATGTATGG - Intronic
967750332 3:193107202-193107224 GTGACCTCTTTTTAAATGTATGG - Intergenic
968291735 3:197544396-197544418 AGGTTTTGTTCTTAAATGTAAGG - Intronic
969270463 4:6096192-6096214 AGGATTTTTTTTTAAAGGTAGGG - Intronic
969395604 4:6918694-6918716 AGGATTTCCTCTTACATGTGTGG + Intronic
970710568 4:18857329-18857351 AGTACCTCTGATTAAATGTATGG - Intergenic
971543765 4:27857887-27857909 ATTAATTCTTCTTAAATGTATGG + Intergenic
972233201 4:37099278-37099300 AGCTTCTCTTCTTCAATGTGGGG - Intergenic
972661325 4:41119310-41119332 AGGATCTCTAGCTAAATGTGTGG + Intronic
972713629 4:41623894-41623916 AGGATTTCTTAATAAATGTGTGG + Intronic
974247534 4:59339897-59339919 AGGATCACTACTGAATTGTAAGG + Intergenic
974695030 4:65356261-65356283 AGGATCTCTTTTTAGAGTTATGG + Intronic
974828787 4:67163818-67163840 AAAATTTCTTCTTAAATATATGG + Intergenic
975405958 4:73989834-73989856 AGCATTTCTTCTAAAATTTAAGG - Intergenic
975474709 4:74810261-74810283 AGAATATATTTTTAAATGTATGG + Intergenic
977344842 4:95804600-95804622 AGTTTTTCTTATTAAATGTATGG - Intergenic
977479729 4:97560470-97560492 AGGTACTCTTTGTAAATGTAAGG + Intronic
977526645 4:98154016-98154038 AGGTTTTTTTCTTAAAGGTATGG + Intergenic
977614412 4:99071980-99072002 AGGATCTGTTCTTTAATCAACGG + Exonic
979632832 4:122922638-122922660 TGGCACTCTTCTAAAATGTACGG - Intronic
980483429 4:133421209-133421231 AGGAACTTTTTTAAAATGTAAGG + Intergenic
981294142 4:143110813-143110835 AGGCTCTGTTAATAAATGTAAGG - Intergenic
981933751 4:150217302-150217324 AGCATCTATTGTTAAATATAAGG - Intronic
982366216 4:154582138-154582160 CTGACCACTTCTTAAATGTAGGG - Intergenic
982482090 4:155924099-155924121 AGAACCTCTTCTTAAGTGTATGG - Exonic
982654232 4:158126861-158126883 AGCATTTCTGTTTAAATGTATGG + Exonic
983402675 4:167285206-167285228 AGGATCTCCTCTTCAATAAATGG - Intergenic
988273836 5:29054673-29054695 AGGTTCTGTTAATAAATGTAAGG - Intergenic
988853202 5:35199174-35199196 ATGAGCTCTTCTTAATTATAAGG + Intronic
990280551 5:54246335-54246357 AGAGTGTCTTCTGAAATGTAGGG - Intronic
992217092 5:74536977-74536999 AGTATTTCTTTTTAAATGTGGGG + Intergenic
995265824 5:110159086-110159108 AAAATCTCTTCCTATATGTATGG - Intergenic
995386022 5:111589896-111589918 AGGCTCTCTACTTAGATGTAAGG - Intergenic
995417882 5:111930261-111930283 AGGATTTCTCTTTAAATGTTAGG + Intronic
995516474 5:112959419-112959441 AGGATGTCTTCTTAACTGATTGG - Intergenic
995728002 5:115202773-115202795 AGGATTCCTTCACAAATGTAAGG + Intergenic
998973068 5:147613780-147613802 AGAAACTCTTCTTTAAAGTAAGG + Intronic
999693405 5:154168069-154168091 AGGATCTCTTCTTGGATGTGAGG - Intronic
1001949272 5:175804859-175804881 AGGATCTCTTCTTACGTCTTGGG - Intronic
1004113107 6:12739969-12739991 AGGAAATCTTTTGAAATGTAGGG - Intronic
1004935539 6:20504405-20504427 AGGATCACTTTTTCAATGAATGG + Intergenic
1009603563 6:65836494-65836516 AGGATCTGTTCTTCAATCAACGG + Intergenic
1010185504 6:73139187-73139209 TGTATCTCTTCTTAAAAGTGAGG + Intronic
1011024292 6:82849738-82849760 AGTAGTTCTCCTTAAATGTATGG - Intergenic
1011442322 6:87399833-87399855 AGGCTCTCTTCTTAGGTGTGGGG + Intergenic
1011591373 6:88973562-88973584 AAATTCTCTTCATAAATGTAGGG - Intergenic
1012454933 6:99393406-99393428 AGGATCTCTTTAAAAATGTTAGG - Intronic
1012656544 6:101830177-101830199 AGGATATCTTATTCAATGAATGG + Intronic
1012686952 6:102262562-102262584 AGCATCTGTTCTTAAATATATGG + Intergenic
1012701310 6:102460390-102460412 AGTATCCCTTATTTAATGTATGG + Intergenic
1014769367 6:125444219-125444241 AGGAACTTTTCCTAAAAGTAAGG + Intergenic
1015300556 6:131649017-131649039 AGGATGACTTCCAAAATGTAAGG - Intronic
1015566335 6:134575360-134575382 AGGATGTCTTTTTGAATGTCAGG + Intergenic
1017235622 6:152114484-152114506 AGGTTTTCATCTTAAATGCATGG - Intronic
1017800095 6:157887613-157887635 AGGATCACTTCTTCACTGTCTGG + Intronic
1020363204 7:7352226-7352248 TTGAGTTCTTCTTAAATGTAAGG + Intergenic
1021245977 7:18261413-18261435 AGGATTTATTCTTAAATGAGTGG - Intronic
1028311147 7:89337963-89337985 AGGATATCTTATTAAATATCTGG + Intergenic
1028477888 7:91271031-91271053 AAGATCCCATTTTAAATGTAAGG - Exonic
1031493657 7:122420881-122420903 AGGATCTCTTCTTAAATGTATGG - Intronic
1031600687 7:123704788-123704810 TAGATCTCTACTTAAATGTCGGG - Intronic
1036988319 8:13562552-13562574 AGGGTATGTTCTCAAATGTATGG - Intergenic
1037053914 8:14411985-14412007 CTGCTCTCTTCTTAAATGCAAGG + Intronic
1037520798 8:19679112-19679134 AGGAACTCTTCTTAAAGGTAAGG + Intronic
1040698059 8:50026607-50026629 ATGGTCTATTTTTAAATGTATGG - Intronic
1041310946 8:56515888-56515910 CAGATGTCTTCTTAAATGTTTGG - Intergenic
1042654190 8:71077588-71077610 AGGATCTCTTCCTGATAGTATGG + Intergenic
1045631233 8:104125735-104125757 ACTACCTGTTCTTAAATGTATGG + Intronic
1046867376 8:119165411-119165433 AGGATCTCTATTTTAATGTTAGG + Intronic
1046960354 8:120105283-120105305 AAGATCTCTTCATAGGTGTAAGG + Intronic
1048040904 8:130727686-130727708 AGGAGCTCTTCATCACTGTAGGG - Intergenic
1049017795 8:139933243-139933265 AAGATCTCTTCTAACATTTAAGG + Exonic
1049314798 8:141958913-141958935 TGGATTTCTTCTTTAATGCATGG - Intergenic
1050275589 9:3994839-3994861 AGAATCTCTTTTTTAATGCATGG + Intronic
1051639208 9:19208957-19208979 ATGATCTCTTCTTAGGTGAAGGG - Intergenic
1053282714 9:36831387-36831409 AGGATGTCTTCTCCACTGTAAGG - Intergenic
1053289969 9:36873333-36873355 AGGGTCTCTTAGGAAATGTATGG + Intronic
1054851898 9:69855012-69855034 AGGATCTCTTTATAAACGTGTGG - Intronic
1056106430 9:83351444-83351466 AGGTTCTTTTCTTAAATCTTGGG - Intronic
1060038936 9:120283193-120283215 AGATTCTCCTCTTAAATGTGGGG - Intergenic
1062114842 9:134802810-134802832 AGAATCTCTTCCTAAATCTAAGG - Intronic
1186180082 X:6965067-6965089 AGGCTCTCTTCTTTGATTTAAGG + Intergenic
1192635535 X:72812793-72812815 AGGATCTCCTATTAAATAAATGG - Intronic
1192646179 X:72908010-72908032 AGGATCTCCTATTAAATAAATGG + Intronic
1192937610 X:75876894-75876916 AGGATCTCCTATTTAATATATGG - Intergenic
1194939949 X:99997694-99997716 AGGAACTTTGCTTCAATGTAAGG - Intergenic
1199355707 X:146861263-146861285 AGGAGGTGTTCTTGAATGTAGGG - Intergenic