ID: 1031493668

View in Genome Browser
Species Human (GRCh38)
Location 7:122420905-122420927
Sequence CTGGGGAAGGGGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4808
Summary {0: 2, 1: 4, 2: 73, 3: 556, 4: 4173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031493656_1031493668 4 Left 1031493656 7:122420878-122420900 CCTCCATACATTTAAGAAGAGAT 0: 1
1: 0
2: 1
3: 20
4: 255
Right 1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG 0: 2
1: 4
2: 73
3: 556
4: 4173
1031493657_1031493668 1 Left 1031493657 7:122420881-122420903 CCATACATTTAAGAAGAGATCCT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG 0: 2
1: 4
2: 73
3: 556
4: 4173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031493668 Original CRISPR CTGGGGAAGGGGAGGGAGGA TGG Intronic
Too many off-targets to display for this crispr