ID: 1031493934

View in Genome Browser
Species Human (GRCh38)
Location 7:122423356-122423378
Sequence TAGCCACAAGTTCTAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 167}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031493934_1031493936 -10 Left 1031493934 7:122423356-122423378 CCAGTTTTTAGAACTTGTGGCTA 0: 1
1: 0
2: 0
3: 13
4: 167
Right 1031493936 7:122423369-122423391 CTTGTGGCTAGGTGCACCTAAGG 0: 1
1: 0
2: 0
3: 2
4: 41
1031493934_1031493939 16 Left 1031493934 7:122423356-122423378 CCAGTTTTTAGAACTTGTGGCTA 0: 1
1: 0
2: 0
3: 13
4: 167
Right 1031493939 7:122423395-122423417 TTTTGGACTCAGTACCCTAAAGG 0: 1
1: 0
2: 0
3: 6
4: 98
1031493934_1031493937 -1 Left 1031493934 7:122423356-122423378 CCAGTTTTTAGAACTTGTGGCTA 0: 1
1: 0
2: 0
3: 13
4: 167
Right 1031493937 7:122423378-122423400 AGGTGCACCTAAGGAACTTTTGG 0: 1
1: 0
2: 0
3: 9
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031493934 Original CRISPR TAGCCACAAGTTCTAAAAAC TGG (reversed) Intronic
907703693 1:56814597-56814619 TAGTCACAAGTCCAAAAGACTGG - Intronic
908871113 1:68613777-68613799 GAGGAACAAGTTCTCAAAACTGG - Intergenic
909399342 1:75209250-75209272 TAGCCAAAACTTCCAAAGACTGG + Intronic
911481832 1:98452636-98452658 TAGCCAGAAATTTTTAAAACAGG - Intergenic
911578752 1:99610122-99610144 TATCCATAATTACTAAAAACTGG - Intergenic
914808952 1:151012543-151012565 GAGCCACAAGTGCTAGAAGCTGG + Intronic
920179794 1:204125587-204125609 AATATACAAGTTCTAAAAACTGG + Intronic
921101865 1:211935488-211935510 TCGCCACATTTTCTAAAAATAGG + Intergenic
921504112 1:215945489-215945511 TAGCCACCAGTTGTATTAACAGG + Intronic
923895512 1:238265312-238265334 TAGCCACAAGAATTGAAAACAGG + Intergenic
1065265010 10:23965773-23965795 TAGCCTCAAGCACTAGAAACTGG - Intronic
1066322384 10:34317029-34317051 TAGCAAAAAGTACTAAAAACTGG - Intronic
1068925935 10:62538383-62538405 TAGTCATAAGTACCAAAAACTGG + Intronic
1071347232 10:84704307-84704329 CAGCCACAAGTGCTAGACACGGG + Intergenic
1073226663 10:101926652-101926674 TAGCCACAAAGTGTATAAACAGG - Intronic
1075264400 10:120988479-120988501 TAGCCACAAGCTCTAAATCCAGG + Intergenic
1078801554 11:14650013-14650035 CTGCCCCAAGTTCTAAGAACAGG - Intronic
1079914887 11:26356811-26356833 CAGCCACAAGTTAAAAATACAGG - Intronic
1085681898 11:78583938-78583960 TAGCCACGAATTTTCAAAACTGG + Intergenic
1086302749 11:85446013-85446035 AAGCCACAAGTTGTAAACAATGG - Intronic
1086353391 11:85966410-85966432 TAGGAACAATTTCCAAAAACAGG + Intronic
1089673340 11:120072368-120072390 TTGCCCCCAGTTCTAAGAACTGG - Intergenic
1090123418 11:124057530-124057552 TATCCAAAAGAACTAAAAACAGG - Intergenic
1090538196 11:127670013-127670035 TATCCATAATTTCCAAAAACTGG + Intergenic
1090974397 11:131669358-131669380 TAGCCACCAGTTCTCAGAGCAGG - Intronic
1091856783 12:3746884-3746906 CAACCACAAGCTCTCAAAACAGG + Intronic
1093339810 12:17959889-17959911 TTGCCATTAGTACTAAAAACAGG - Intergenic
1095633981 12:44409657-44409679 AAGCCACAAGAGCTATAAACTGG + Intergenic
1097971142 12:65634270-65634292 CAGCAACAAGTTCTGACAACAGG - Intergenic
1099473591 12:83080619-83080641 TAGACACAGGTTCAAAAACCCGG - Intronic
1102681420 12:114692986-114693008 TAGCAGCAAGTTTTATAAACAGG + Intergenic
1103483677 12:121268186-121268208 TAGCCACAATAACTAAAAAGTGG - Intronic
1104244543 12:127025095-127025117 GAGCCACAGGTTCTAAACCCAGG - Intergenic
1106155291 13:27149385-27149407 TAGCCAGCAGTTAGAAAAACAGG + Intronic
1106711232 13:32335508-32335530 AAACCACAATTTTTAAAAACAGG - Intronic
1108639381 13:52368552-52368574 TAGCCAAAAGTATTGAAAACAGG + Intergenic
1109679531 13:65731862-65731884 TAGCCACAAGTCATAAATTCTGG + Intergenic
1112468944 13:99670495-99670517 TAGACACGTGCTCTAAAAACAGG + Intronic
1113834089 13:113317427-113317449 TAACCACCAGTTTAAAAAACTGG - Intronic
1114426269 14:22626159-22626181 TAGCCATAAGTCCTAATAGCAGG + Intergenic
1115222660 14:31072802-31072824 AAGCCACATGCTCTAAAACCTGG + Intronic
1117305115 14:54466507-54466529 TAGCCATAAGTTCCAAAAGTGGG - Intergenic
1118123339 14:62870993-62871015 TAGCCATAAGATCTTAAAATAGG + Intronic
1120212164 14:81643906-81643928 TAATCACAAGTTCTTAAAAGTGG + Intergenic
1126145243 15:45467675-45467697 TAGTCACAATGGCTAAAAACTGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1129745148 15:78013784-78013806 CAGCCACAGGTTCCAATAACTGG - Intronic
1129819126 15:78584767-78584789 TAGGCAAAAGTTCTAAACAGAGG - Intronic
1130901346 15:88209069-88209091 TAGGCATAAGTTCTATAAACTGG + Intronic
1132006288 15:98230436-98230458 TAGCCACATGCTCTAACCACAGG + Intergenic
1133398838 16:5469986-5470008 TACCCACAAGAACCAAAAACAGG - Intergenic
1135177267 16:20241474-20241496 TAACCACAAGTGCTAACCACAGG + Intergenic
1135378307 16:21970281-21970303 TAACCAAAAGAACTAAAAACAGG - Intronic
1135764383 16:25164903-25164925 AAGACAGAAGTTCTAATAACTGG - Intronic
1137335609 16:47546172-47546194 AAGCTGAAAGTTCTAAAAACAGG - Intronic
1137565613 16:49530906-49530928 CAGCCACAAGACCTAAAACCTGG + Intronic
1137597410 16:49734088-49734110 GAGGCAGAAGTTCTAACAACAGG + Intronic
1137682923 16:50366981-50367003 TAGCCAAAGGTAATAAAAACTGG + Intronic
1141181634 16:81756925-81756947 CATACACAATTTCTAAAAACAGG - Intronic
1142873158 17:2834375-2834397 CAGGAACAAGTTCTAAGAACTGG + Intronic
1147528671 17:41252869-41252891 GAGCCACAAGCTCTAAAAGAAGG + Intronic
1149644728 17:58232072-58232094 CAGCCCCAAGTTCTAAAACGTGG - Intronic
1161602430 19:5192657-5192679 TACCCACATGGTCTAAAAAGGGG - Intronic
1161914833 19:7220595-7220617 TTGGCACAAGTTGTAAAAATAGG - Intronic
1165089893 19:33379705-33379727 AAGCCACAAGCTCTAAAGTCTGG - Exonic
926528813 2:14016287-14016309 TAGTCATAAGTACTAAAAAATGG + Intergenic
929214222 2:39393668-39393690 TAGGCACAAATTCTAGAAATTGG - Intronic
932177027 2:69612293-69612315 TAACCACAACTTTTAAAAAAGGG + Intronic
935750744 2:106231765-106231787 TATCCAAAAGAACTAAAAACAGG - Intergenic
941168951 2:162114425-162114447 TAGCAAGAAAATCTAAAAACAGG - Intergenic
941632637 2:167901562-167901584 TAGCCATTATTTTTAAAAACAGG - Intergenic
941990070 2:171547108-171547130 TAGCCACAAGTTTGAATAAGTGG + Intronic
942018486 2:171842030-171842052 TAGCCAAAAGAACTGAAAACAGG + Intronic
942889585 2:180972153-180972175 TGGCCTCAAGGTCTAAAAACAGG - Intronic
944025339 2:195158768-195158790 TAGCCACATATATTAAAAACAGG + Intergenic
945018503 2:205546650-205546672 TAACCACAACTTCTTAAAATTGG + Intronic
946812812 2:223544334-223544356 TAGTCACAATTGCTAAAAACTGG - Intergenic
947175727 2:227365395-227365417 TAGACACAATTTGTAAAAACTGG - Intronic
1169200917 20:3709579-3709601 TACCCAAAAGTACTGAAAACAGG + Intergenic
1170617137 20:17962857-17962879 TAGCCTCAAGTTCCTAGAACAGG + Intronic
1171090546 20:22282087-22282109 TAAGCAAAAGTTCTAAAAAACGG + Intergenic
1173782604 20:45769093-45769115 TACCCAAAAGAACTAAAAACAGG - Intronic
1175209069 20:57337544-57337566 TAGCCAAAATATCTAACAACAGG - Intronic
1177287270 21:19068201-19068223 CAGCCACAAGTATTAAAAATAGG - Intergenic
1177676129 21:24302018-24302040 AAGCCACAAGTTGTGAAAACTGG - Intergenic
1179466075 21:41574132-41574154 TATTCACAATTGCTAAAAACTGG - Intergenic
1182936800 22:34230656-34230678 ATGCCACAAGTTCTATAAATTGG - Intergenic
950700016 3:14737124-14737146 TATCAAGAAGTTCTACAAACTGG - Intronic
951006121 3:17617982-17618004 AAGCTGAAAGTTCTAAAAACTGG - Intronic
955486528 3:59439637-59439659 TGGCCCCTAGTTCTGAAAACCGG - Intergenic
957667961 3:83260960-83260982 AAACCACAAGTTCTAGAATCAGG + Intergenic
960090969 3:113637681-113637703 TTGAGACAAGTTCTAAAAAGAGG - Intergenic
963208450 3:142661014-142661036 TTGCCTCAAGTTTTAAAAATAGG - Intronic
963278296 3:143355316-143355338 TAGCCACATGTCTTAAAGACAGG - Intronic
964679646 3:159323420-159323442 AACCCACAAATTCTAAAAAAGGG - Intronic
966383195 3:179364499-179364521 TAGAAAAAACTTCTAAAAACAGG + Intronic
966619829 3:181952024-181952046 TAGCCCAAAGTTTTAAAAAAGGG + Intergenic
967364029 3:188665295-188665317 TTGTCACAAAATCTAAAAACTGG + Intronic
971057179 4:22926843-22926865 AAGCCACAGTTTCTAAGAACTGG + Intergenic
971589297 4:28446587-28446609 TAGCCACACATTCTATAACCAGG + Intergenic
972366019 4:38375214-38375236 TAGCCAGAATTTTTAAAAAATGG + Intergenic
972825334 4:42752023-42752045 TATCCACAATATCTAAAAAGAGG - Intergenic
973623590 4:52750703-52750725 TACTCACAAGTCCTAAAGACAGG + Intronic
973993141 4:56431989-56432011 CAGCCAGAACTACTAAAAACGGG + Intronic
975347053 4:73303970-73303992 TATTCCCATGTTCTAAAAACAGG - Intergenic
975529297 4:75384650-75384672 TAGCCTCAAGATCTAAGAAATGG + Intergenic
975845662 4:78522787-78522809 GAGCCACAAGCTCTTATAACAGG + Intronic
978077470 4:104550809-104550831 TAGACAGAAATTCTAATAACTGG + Intergenic
979435568 4:120685111-120685133 TTGCCATAAGTAATAAAAACTGG - Intronic
980254839 4:130365758-130365780 TAGCCAAAAGGGCAAAAAACAGG - Intergenic
980859841 4:138486151-138486173 GATCCACCAGTTCTAAGAACTGG + Intergenic
981434200 4:144700548-144700570 TAATCACAAGTTCTTAAAAGTGG + Intronic
981515358 4:145602743-145602765 AATCCACAAGTACTAAATACAGG + Intergenic
981715598 4:147748788-147748810 TAGACCCTATTTCTAAAAACAGG + Intronic
982165016 4:152606340-152606362 TTTCCACAAATTCTAAAAACTGG - Intergenic
983525522 4:168756858-168756880 TAGAGAGAAGTTCTAAGAACCGG + Intronic
983590022 4:169398577-169398599 TTTCCACATTTTCTAAAAACAGG - Intronic
983595540 4:169462669-169462691 TAGACACAACTTCTAAAAAGAGG + Intronic
984952043 4:185015146-185015168 AATCCTCAATTTCTAAAAACTGG + Intergenic
988379643 5:30483423-30483445 TACACACATGTTCTAAAAAATGG - Intergenic
989006166 5:36815064-36815086 TAGCCAGAAGTTATAACAGCTGG + Intergenic
989513654 5:42317469-42317491 TAGCAGCAAGTTCTAGATACTGG + Intergenic
990074717 5:51829875-51829897 TGTCAACAAGTTCTACAAACTGG + Intergenic
993473196 5:88332207-88332229 AAGACACAATTTTTAAAAACAGG - Intergenic
993719966 5:91312503-91312525 TATCAACAAGTCATAAAAACAGG + Intergenic
994368113 5:98939075-98939097 TAGCCAGATTTTCTAATAACTGG + Intergenic
994985966 5:106933879-106933901 TAGCCAAAATATCTAAGAACTGG - Intergenic
995883191 5:116865313-116865335 TAGTCACAATTACTGAAAACTGG + Intergenic
998783738 5:145686443-145686465 TAGCAACAAGATCTAAACAGGGG + Intronic
999949296 5:156631703-156631725 CAGGCAAAAGTTGTAAAAACAGG - Intronic
1000570595 5:162908748-162908770 TTTCCTCAAGTTCTAACAACTGG - Intergenic
1001106038 5:168855373-168855395 TAGCCAAAAGAATTAAAAACAGG + Intronic
1003153601 6:3572805-3572827 AAGCCTCAGTTTCTAAAAACTGG + Intergenic
1005109895 6:22269262-22269284 TTGACACAAGTTCCCAAAACCGG + Intergenic
1005529544 6:26689277-26689299 GAGCCAAAAGTTCTAAAACGGGG - Intergenic
1005541252 6:26812370-26812392 GAGCCAAAAGTTCTAAAACGGGG + Intergenic
1005990848 6:30900926-30900948 TAATAACAAGATCTAAAAACAGG + Intergenic
1008153493 6:47986087-47986109 TAGACAAAAGTTCTACAAACAGG - Intronic
1008190123 6:48445834-48445856 TAGGTACAGGTTCTGAAAACTGG + Intergenic
1009012058 6:57854438-57854460 GAGCCAAAAGTTCTAAAACGGGG + Intergenic
1010897973 6:81389564-81389586 TGGCCACAAATTCTAAAATGGGG + Intergenic
1011353464 6:86448637-86448659 CAGCCACAGTTTTTAAAAACTGG + Intergenic
1011819198 6:91230490-91230512 TATTCACAGGTTCTAGAAACAGG - Intergenic
1012303326 6:97617959-97617981 TAGCATCATATTCTAAAAACTGG - Intergenic
1014187265 6:118449204-118449226 CAGCCAGAAGTTATCAAAACTGG - Intergenic
1016006628 6:139095493-139095515 TAGCCAAAGATTCTCAAAACAGG - Intergenic
1016980986 6:149853881-149853903 TATCCTCAAGTTTTAAAAATAGG + Intronic
1019471968 7:1225778-1225800 TAGCCACAGATCCTACAAACAGG + Intergenic
1024993069 7:55251445-55251467 TAGCCACAATGTATGAAAACAGG + Intronic
1026119482 7:67524385-67524407 TACCCATAAGCTCTAAAAAGGGG - Intergenic
1028963815 7:96779357-96779379 TATTCACAAATTCAAAAAACTGG + Intergenic
1031370698 7:120961877-120961899 TAGCCACAGATTCCTAAAACAGG - Intronic
1031493934 7:122423356-122423378 TAGCCACAAGTTCTAAAAACTGG - Intronic
1032608578 7:133386370-133386392 AAGCAACACCTTCTAAAAACAGG - Intronic
1035207335 7:157302430-157302452 TAGGCACACATTTTAAAAACTGG + Intergenic
1037286923 8:17311433-17311455 TTGCCAGTAGTTGTAAAAACAGG + Intronic
1041331274 8:56728419-56728441 CAGCCACGTGTTCTGAAAACGGG - Intergenic
1047914969 8:129573218-129573240 TAGCCACAAGTCCAAAAAAAGGG + Intergenic
1049570476 8:143368108-143368130 TGGAAACAAGTTCTACAAACAGG + Intergenic
1050702850 9:8360375-8360397 TAGTCCCAAATTTTAAAAACTGG + Intronic
1050785126 9:9391257-9391279 TAGCCTCTAGTTTTGAAAACTGG - Intronic
1051521771 9:17997203-17997225 AAGCCACATGGTCTAAAAACAGG + Intergenic
1052144873 9:25036620-25036642 CTGCCACAAGTTATCAAAACAGG - Intergenic
1053115173 9:35493959-35493981 TACCCACAAGAACTAAAAGCAGG - Intronic
1053304868 9:36977286-36977308 TAGTCACAAGATCTAAAGATTGG + Intronic
1053594795 9:39548883-39548905 TAATCACAAGTTCTTAAAAGTGG + Intergenic
1054571458 9:66816084-66816106 TAATCACAAGTTCTTAAAAGTGG - Intergenic
1054784047 9:69193379-69193401 TAGCTACAAATTCTACAAAAAGG + Intronic
1054958958 9:70945822-70945844 CAGCCCCAAGTTGTAAGAACTGG + Intronic
1056058561 9:82857422-82857444 AAGCCACAAGTTTTCAAAATTGG + Intergenic
1056975967 9:91254216-91254238 TAGCCCCAAGTTATAAAATCTGG - Intronic
1059073204 9:111161574-111161596 TGGCCACAAGTATTTAAAACTGG + Intergenic
1185919128 X:4069632-4069654 TAACCACAATTGCCAAAAACTGG - Intergenic
1187490933 X:19750702-19750724 TATCCACAGGCTCTAAAAATAGG + Intronic
1187600384 X:20823148-20823170 TACCCAAAAGTACTAAAAGCAGG + Intergenic
1189191189 X:39107682-39107704 TAGCCAAAAGAATTAAAAACAGG - Intergenic
1193014613 X:76718664-76718686 TGGCCACCAGTTTTCAAAACTGG - Intergenic
1193182956 X:78480414-78480436 TATCCAAAAGAACTAAAAACAGG + Intergenic
1194618922 X:96143891-96143913 TACCCAAAAGTTCTGAAAGCAGG + Intergenic
1195947044 X:110226291-110226313 TTGCCAATGGTTCTAAAAACAGG + Intronic
1197764197 X:130049134-130049156 TACCCAAAAGAACTAAAAACAGG - Intronic