ID: 1031496449

View in Genome Browser
Species Human (GRCh38)
Location 7:122454880-122454902
Sequence AGGGATAAGCAGATAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031496449_1031496454 -1 Left 1031496449 7:122454880-122454902 CCAGCCACTATCTGCTTATCCCT 0: 1
1: 0
2: 1
3: 8
4: 189
Right 1031496454 7:122454902-122454924 TGAGTACGCAGGCAGCCTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031496449 Original CRISPR AGGGATAAGCAGATAGTGGC TGG (reversed) Intronic
902224827 1:14990155-14990177 AGGGATCAGCAAACTGTGGCTGG + Intronic
903615073 1:24646229-24646251 AAGAATTAGCAGATTGTGGCTGG + Intronic
905399175 1:37689639-37689661 AGGCGTAAGCAGCTGGTGGCTGG - Exonic
905467290 1:38164853-38164875 GGGAATAAGCAGTAAGTGGCTGG - Intergenic
905808212 1:40892348-40892370 AGGGAGAAACAGAAAGTGACAGG - Intergenic
908656068 1:66390147-66390169 ATGCCTAAGCAGATAGGGGCAGG - Intergenic
909085812 1:71169168-71169190 AAGGAGAAGCACACAGTGGCAGG + Intergenic
910206443 1:84753246-84753268 AGGGATGAGCAGGTAGGGACCGG - Intergenic
911753115 1:101521580-101521602 GTGGATAAGCAGATAGTGAGGGG - Intergenic
913255205 1:116946853-116946875 ATTGATAATAAGATAGTGGCAGG + Intronic
917645308 1:177023722-177023744 AGGGATCAGCAGACAGAGGCTGG + Intronic
919833844 1:201560392-201560414 AGGGATATGCTGATGGTGGAGGG - Intergenic
920295898 1:204956156-204956178 AGGGAAAAACTGATGGTGGCCGG - Intronic
920308836 1:205036158-205036180 AGGCATCAGCAGACAGTGTCTGG - Intergenic
921717887 1:218437029-218437051 AGATATAAGCAGAGAGTGGCTGG - Intronic
1071241503 10:83710891-83710913 AGGGATAACCAAATATTGACAGG + Intergenic
1074035106 10:109730967-109730989 TGAGATGAGCAGATAGAGGCAGG + Intergenic
1077613975 11:3661943-3661965 AGGGATAGGCAGATCCAGGCTGG - Intronic
1078147634 11:8732590-8732612 AGGGACAAACAAATAGTGTCTGG + Intronic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078537341 11:12185592-12185614 ATGGATGAGCAGACTGTGGCTGG + Intronic
1079124647 11:17709838-17709860 AGGGATAAGCAGATTTTGGAGGG + Intergenic
1083680978 11:64351786-64351808 AGGTAGGAGGAGATAGTGGCAGG - Intronic
1084588221 11:70075745-70075767 ACGTATAAGCAGTTAGTGACTGG + Intergenic
1084899387 11:72298319-72298341 AGGGACAAGCAGCAAGTGCCAGG - Intronic
1088743636 11:112786648-112786670 AAGGAAAAGCAGAGACTGGCTGG + Intergenic
1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG + Intergenic
1089875430 11:121716904-121716926 TGGGATAAGCATATAGAGACAGG + Intergenic
1091035935 11:132233451-132233473 AGGGATCAGCAGATTAAGGCAGG + Intronic
1091362648 11:134990122-134990144 AAGGATAGGCAGAGACTGGCAGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1096405303 12:51339806-51339828 AGGGATAGGCAGAGAGTGGCGGG + Intronic
1098651638 12:72977784-72977806 ATGGATAATGAGATAATGGCGGG + Intergenic
1098860050 12:75698786-75698808 AGGAATAAGCAGACAGAAGCTGG + Intergenic
1099347665 12:81523335-81523357 AGGGATAAGAATATAGGGGGTGG - Intronic
1100622495 12:96291971-96291993 AGTGAAAAGGAAATAGTGGCTGG + Intronic
1101543443 12:105685837-105685859 AGGGAATAGAAGATTGTGGCAGG - Intergenic
1103830637 12:123776218-123776240 AGGGAGAAGCAGACAGTGTGAGG + Intronic
1104169162 12:126263122-126263144 AGGGATAAGAAGAGGCTGGCAGG - Intergenic
1104704633 12:130933979-130934001 TGGGATAAGCAGCTAGTGGGGGG - Intergenic
1105985858 13:25566522-25566544 ATGGAAAAGGAGAAAGTGGCAGG + Intronic
1109384491 13:61608924-61608946 AGGGATCAGAAGAAAGTGGAAGG - Intergenic
1110935572 13:81283776-81283798 ATGGCTAGGCAGATAGGGGCAGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1115793970 14:36911706-36911728 AGTTACAATCAGATAGTGGCTGG - Intronic
1117571098 14:57050000-57050022 AGGGAAGAGGTGATAGTGGCTGG - Intergenic
1120164044 14:81175051-81175073 AGGGATAATCAAACAGTGGGAGG - Intergenic
1121229447 14:92345948-92345970 AGTGATCAGGAGATAGTGACTGG + Intronic
1122299499 14:100723823-100723845 AGGGATGCGCAGATAGAGGAGGG + Intergenic
1122370747 14:101227714-101227736 AGGGAGAAGCAGGTCGGGGCAGG + Intergenic
1122381856 14:101313555-101313577 AGGGAGAAGCAGGTCGGGGCAGG - Intergenic
1124004560 15:25785579-25785601 AGGCAGAAGCAGTGAGTGGCAGG + Intronic
1124784737 15:32669007-32669029 AGGGATAAGCAGAGTATGTCGGG - Intronic
1125642344 15:41241762-41241784 AGGGACAAGCAGGTAGTGAGTGG - Intronic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1127213565 15:56800734-56800756 AGAAATATGAAGATAGTGGCCGG - Intronic
1128502186 15:68234284-68234306 AGAGATAAGCAGAATGTGGGTGG + Intronic
1128694964 15:69754708-69754730 AGGAAGGAGAAGATAGTGGCAGG - Intergenic
1131121852 15:89827878-89827900 AGGGATGAGAAGACAGGGGCTGG + Intergenic
1131622364 15:94081438-94081460 AGGGAAAGGCACATGGTGGCCGG + Intergenic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1135604843 16:23814568-23814590 AGGGACAAGGAGATAGAGGAAGG - Intergenic
1136500737 16:30668741-30668763 AGGGTGAAGCAGAGAGTGACAGG - Intronic
1136587899 16:31199601-31199623 TGGTATGAGCAGATAGTGGTGGG + Intergenic
1137642397 16:50044308-50044330 AGGGATCAATAAATAGTGGCCGG + Intergenic
1137656145 16:50159534-50159556 AGAAATAAGCAGAGAGAGGCCGG - Intronic
1138542326 16:57695940-57695962 AGGGAGCAGCAGATAAAGGCTGG - Intronic
1144582336 17:16465991-16466013 AGGGAAAGCCAGATAGAGGCTGG + Intronic
1146299435 17:31676700-31676722 AGGTATGAGCAGAAAGGGGCAGG + Intergenic
1146374407 17:32284633-32284655 AGGGAAAAGCAGACAGCAGCAGG - Intronic
1146528160 17:33584647-33584669 ATGGATGATCAGAGAGTGGCAGG + Intronic
1147400287 17:40176932-40176954 AGGGAGCAGCAGGTTGTGGCAGG - Intergenic
1149664320 17:58355087-58355109 AGGGAGAAGCAGAGACTGTCTGG + Intronic
1151508892 17:74546356-74546378 AGGGACATGCAGATGGTGTCTGG - Intergenic
1152789082 17:82268795-82268817 AGCCAAAAGCAGATGGTGGCCGG + Intronic
1153227193 18:2907926-2907948 AGGGACATGCAGACACTGGCAGG + Intronic
1154489182 18:14906225-14906247 AGGGAGAGGCAGAGACTGGCAGG - Intergenic
1157552736 18:48592750-48592772 AGCGATTAGCAGGGAGTGGCGGG + Intronic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1159264928 18:66068615-66068637 AGGGTTGAGCAGATAGTGTGGGG - Intergenic
1160626377 18:80210238-80210260 ATGGATAAGCAGAGATTTGCAGG - Intronic
1160971929 19:1772997-1773019 AAAGTTAAGCAGATATTGGCCGG - Intronic
1161362435 19:3858294-3858316 TGGGATCTGCAGATAGAGGCAGG + Intronic
1162461328 19:10815913-10815935 AGGGAGAAGCAAAGAGAGGCGGG + Intronic
1165053098 19:33155698-33155720 AGGGAAAAGCAGCTGGTGTCAGG - Intronic
1166303176 19:41923556-41923578 AGGGACAAGGAGACAGGGGCAGG + Intronic
925046866 2:778806-778828 TGTGATAAGCAGATAGTGTGAGG - Intergenic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
928592101 2:32827634-32827656 AGGCATAAGCAAAAAGTGTCTGG + Intergenic
929350320 2:40943063-40943085 ATGGATAAGAAGAAAGTGGAAGG + Intergenic
933737210 2:85504717-85504739 AGGAAAAAGCAGATGGTGGGGGG - Intergenic
934320592 2:91968008-91968030 GGGGAAAACCAGAAAGTGGCAGG - Intergenic
935745621 2:106188168-106188190 AGGGATATGGAGAGAGGGGCAGG - Intronic
938555944 2:132424425-132424447 AGGAATAAGCAGCTACTGCCTGG + Intronic
940023625 2:149181797-149181819 GGGGAAAGGCAAATAGTGGCAGG - Intronic
940767220 2:157802539-157802561 AGAGATAGACAGAAAGTGGCTGG - Intronic
943439393 2:187907815-187907837 AAGGATAAGAAGATAGTAGAAGG + Intergenic
945433610 2:209794430-209794452 AGGGATATACAGATAGTCTCAGG - Intronic
946849354 2:223890017-223890039 AGGGATACACAGAGAGAGGCAGG - Intronic
1169189268 20:3647083-3647105 AGGGATGAGCTGATGGTTGCTGG + Exonic
1169843735 20:9967072-9967094 AGGGATAAAAAGACAGAGGCCGG + Intergenic
1171304930 20:24097041-24097063 AGGGAGAAACAGATAATGCCTGG - Intergenic
1173408686 20:42790536-42790558 AGGGACAAGCAGATCATGGGGGG - Intronic
1173437184 20:43043918-43043940 TGGGATAAGCAGACAGAGGAAGG - Intronic
1173580149 20:44141391-44141413 AGGGAAAGGCAGATGGAGGCGGG + Intronic
1174559441 20:51419545-51419567 AGGGATAAGCAGTCCATGGCTGG - Intronic
1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG + Intergenic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1178600686 21:33991987-33992009 AGGGAGAAGCAGAAAGGTGCAGG + Intergenic
1184459652 22:44629875-44629897 AGGGATAAGCAGGTAGGGCATGG + Intergenic
949875188 3:8621946-8621968 AGCCAGAAGCAGATAGAGGCAGG - Intronic
950686058 3:14619427-14619449 AGGGGTAAGAAGAGAGTGTCTGG + Intergenic
951448351 3:22808204-22808226 AAGGACAAGAAGAGAGTGGCTGG + Intergenic
954435976 3:50496550-50496572 ATGGATGAGGGGATAGTGGCTGG + Intronic
959527994 3:107398903-107398925 AGGGATGAGAAGAAAATGGCTGG - Intergenic
959781446 3:110239023-110239045 AGGGAAAGGAAGGTAGTGGCTGG - Intergenic
961660930 3:128468501-128468523 AGTGATAAGCAGATAGGATCGGG - Intergenic
963112321 3:141697898-141697920 TGGGATAAGGAGACAGTTGCGGG + Intergenic
964062987 3:152547158-152547180 AGGGACAACCAGAGAGTGGAGGG - Intergenic
967574659 3:191076478-191076500 AGGGATGAGCAGGTAGTGTGAGG + Intergenic
968714585 4:2146638-2146660 AGGGGCAGGCAGATAGGGGCAGG + Intronic
969508761 4:7605188-7605210 TGGGATATGCAGACAATGGCTGG - Intronic
969703485 4:8780260-8780282 AGGGATGGGCACATTGTGGCTGG - Intergenic
969919342 4:10523059-10523081 AGGTAAAAGTTGATAGTGGCTGG + Intronic
970004594 4:11398462-11398484 ATGGAGAAGCAGTTAGTGACTGG - Exonic
970833737 4:20374583-20374605 AGGGATAAGAAGAAAGTTGAAGG - Intronic
972926925 4:44020585-44020607 ATAGAAAAGCAAATAGTGGCTGG - Intergenic
973078992 4:45966070-45966092 AGAGAGAAGCTGATAGTGGATGG - Intergenic
974389207 4:61243435-61243457 AGGGAGAAGCAGAGATTGGGTGG - Intronic
974822898 4:67090439-67090461 AGGGAAAAGCAAATTGTGACTGG + Intergenic
974894297 4:67920286-67920308 AGGGAAGAGCAGAGAGAGGCAGG - Intronic
976550789 4:86392778-86392800 AGGGATAAGGAGGAAGTGGCTGG + Intronic
980494717 4:133575797-133575819 AGAGTTAAGCAGAAAGAGGCAGG - Intergenic
981400056 4:144303352-144303374 ATGGATAAGCAGCAATTGGCTGG - Intergenic
984363728 4:178771228-178771250 TGGGAAAAGAAGAGAGTGGCAGG - Intergenic
987569467 5:19637674-19637696 CGGGATAAGCAGACATTGACTGG - Intronic
989272589 5:39550485-39550507 AGGGAGTAGCAGAAAGTGTCAGG + Intergenic
989601220 5:43202448-43202470 AGGGGTAAAGAGACAGTGGCAGG - Intronic
992106932 5:73456992-73457014 GGGGAAAAACAGATATTGGCGGG - Intergenic
994777149 5:104049439-104049461 ACGCCTAAGCAGATAGGGGCGGG + Intergenic
995763120 5:115585375-115585397 GGAGATAAGCAGATTGTGCCAGG + Intronic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
999957252 5:156716296-156716318 TGGGATAATAAGACAGTGGCAGG - Intronic
1000953738 5:167517423-167517445 AGGGATAGGGAGATAATGGATGG + Intronic
1002925261 6:1602102-1602124 AGGGAAAAGGAGAGAGTGGGTGG - Intergenic
1004254948 6:14054871-14054893 AGTGATATGCAGACAGTGGTGGG - Intergenic
1004272814 6:14210815-14210837 ATGGATAAGCAACAAGTGGCTGG + Intergenic
1004439032 6:15629192-15629214 AGGGCTTAGCAAATAGTGGGTGG - Intronic
1004983312 6:21050842-21050864 AGTGACAGGCAGATAGGGGCAGG - Intronic
1005034677 6:21544710-21544732 AGGGTTAAGCAGTTAGGGGTGGG - Intergenic
1005749606 6:28870657-28870679 AGGGCCTAGCAGATATTGGCGGG + Intergenic
1011525922 6:88264668-88264690 AGAGGTAAGCAGATAGTCACAGG - Intergenic
1013212432 6:107999107-107999129 AGGGGTCAGCAGAAAGTGCCTGG - Intergenic
1015523575 6:134154654-134154676 AAGAATAAACAGCTAGTGGCCGG - Intergenic
1016206534 6:141473848-141473870 ATGCCTAAGCAGATAGGGGCTGG - Intergenic
1016429782 6:143970985-143971007 AGGGAGAGGCAGAGAGTGGAGGG - Intronic
1016433879 6:144015365-144015387 AGGGATAGGCAGAGACTGGCTGG + Intronic
1017118142 6:150997929-150997951 AGGCATGAGCACAAAGTGGCAGG + Intronic
1019723963 7:2590466-2590488 AGTGATAAAAAGATACTGGCCGG + Intronic
1022634359 7:32118117-32118139 AGGGCTAAGGAGAGAGTGGAGGG + Intronic
1022767256 7:33427344-33427366 AGAGATAAGAATAGAGTGGCTGG + Intronic
1027297631 7:76794018-76794040 AGGGATAAGCACACAGGGTCAGG - Intergenic
1027428246 7:78083343-78083365 AGGGAGAAGGAGATGGTGGGGGG + Intronic
1027632291 7:80621810-80621832 ATGCCTAGGCAGATAGTGGCAGG + Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1028462332 7:91108611-91108633 AGTTATAAACATATAGTGGCAGG - Intronic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031496449 7:122454880-122454902 AGGGATAAGCAGATAGTGGCTGG - Intronic
1032542561 7:132715478-132715500 AGGCATAAGCAGCTATTGCCAGG + Intronic
1032871215 7:135988114-135988136 AGGGCTAAGCAGAAAGTAGAGGG - Intergenic
1036047260 8:5157801-5157823 AGGGGTCAGCGGAGAGTGGCTGG + Intergenic
1037409478 8:18581004-18581026 AGAGAGAAGCAGAGACTGGCAGG + Intronic
1040498898 8:47990492-47990514 TGGGATAAGGAGACAGTCGCAGG + Intergenic
1042283064 8:67076110-67076132 TGTGATATGTAGATAGTGGCAGG - Intronic
1042375586 8:68047373-68047395 AGGGATAAACAGATACTATCAGG + Intronic
1042956865 8:74260310-74260332 AGGGTTATGCGGAAAGTGGCAGG + Intronic
1044338155 8:91014186-91014208 AGAGATAAGCCAATAATGGCAGG + Intronic
1047364098 8:124196406-124196428 AGAGAAAAGCAGATAGTTGAGGG - Intergenic
1048184293 8:132225366-132225388 AGTGAGAAGGAGATTGTGGCTGG + Intronic
1048324480 8:133428576-133428598 AGAGAGAAGCATAGAGTGGCTGG - Intergenic
1049994920 9:1025658-1025680 AGGTATAAGCAGTTTGTGTCTGG + Intergenic
1051372066 9:16367176-16367198 AGGGATAAGGAGAGAGTGATTGG - Intergenic
1052415106 9:28167947-28167969 AGGGCTGAGGAGATACTGGCTGG - Intronic
1058639069 9:107065535-107065557 TGGGATCAGAAGATAGTGACTGG - Intergenic
1059385659 9:113962321-113962343 AGGGAAAAGATGATGGTGGCAGG - Intronic
1059980774 9:119769551-119769573 AGGGATAAGAAAATTGCGGCCGG + Intergenic
1060183245 9:121548033-121548055 AGGGAAAAGCAGGTAGCGACAGG - Intergenic
1061546099 9:131305251-131305273 ATGGATAAACAAATTGTGGCCGG + Intronic
1188536914 X:31207098-31207120 AGGGCTGAGCAGTTAGTTGCTGG - Intronic
1191797970 X:65043093-65043115 ATGGATAATCAGATCCTGGCTGG - Intergenic
1192763926 X:74123785-74123807 AGGGAGAGGTAGATAGTGACTGG + Intergenic
1193807542 X:86012809-86012831 AGGCCTAGGCAGACAGTGGCAGG + Intronic
1195022594 X:100844901-100844923 AGGGATAAGCTCACAGTGGATGG - Intronic
1196309646 X:114148586-114148608 AGGCAAAAGGAGATGGTGGCTGG + Intergenic
1198994621 X:142560295-142560317 AGGAATGAGCAGGGAGTGGCAGG + Intergenic
1199858541 X:151779560-151779582 AGGGAAAAGGAGATGGGGGCAGG + Intergenic
1201438758 Y:13986105-13986127 AGGGAGAAGCAGTTCGTGGAGGG - Exonic
1201445815 Y:14056603-14056625 AGGGAGAAGCAGTTCGTGGAGGG + Exonic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic