ID: 1031497329

View in Genome Browser
Species Human (GRCh38)
Location 7:122466404-122466426
Sequence AAAACACTGTGGCCCCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 241}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031497329_1031497341 3 Left 1031497329 7:122466404-122466426 CCCCTCTGGGGCCACAGTGTTTT 0: 1
1: 1
2: 1
3: 17
4: 241
Right 1031497341 7:122466430-122466452 GCAACATGGGGGTGGTAGGCGGG No data
1031497329_1031497334 -10 Left 1031497329 7:122466404-122466426 CCCCTCTGGGGCCACAGTGTTTT 0: 1
1: 1
2: 1
3: 17
4: 241
Right 1031497334 7:122466417-122466439 ACAGTGTTTTCCAGCAACATGGG 0: 1
1: 0
2: 1
3: 21
4: 236
1031497329_1031497337 -5 Left 1031497329 7:122466404-122466426 CCCCTCTGGGGCCACAGTGTTTT 0: 1
1: 1
2: 1
3: 17
4: 241
Right 1031497337 7:122466422-122466444 GTTTTCCAGCAACATGGGGGTGG No data
1031497329_1031497343 7 Left 1031497329 7:122466404-122466426 CCCCTCTGGGGCCACAGTGTTTT 0: 1
1: 1
2: 1
3: 17
4: 241
Right 1031497343 7:122466434-122466456 CATGGGGGTGGTAGGCGGGGAGG 0: 1
1: 0
2: 3
3: 52
4: 551
1031497329_1031497340 2 Left 1031497329 7:122466404-122466426 CCCCTCTGGGGCCACAGTGTTTT 0: 1
1: 1
2: 1
3: 17
4: 241
Right 1031497340 7:122466429-122466451 AGCAACATGGGGGTGGTAGGCGG 0: 1
1: 0
2: 2
3: 37
4: 323
1031497329_1031497335 -9 Left 1031497329 7:122466404-122466426 CCCCTCTGGGGCCACAGTGTTTT 0: 1
1: 1
2: 1
3: 17
4: 241
Right 1031497335 7:122466418-122466440 CAGTGTTTTCCAGCAACATGGGG No data
1031497329_1031497336 -8 Left 1031497329 7:122466404-122466426 CCCCTCTGGGGCCACAGTGTTTT 0: 1
1: 1
2: 1
3: 17
4: 241
Right 1031497336 7:122466419-122466441 AGTGTTTTCCAGCAACATGGGGG No data
1031497329_1031497342 4 Left 1031497329 7:122466404-122466426 CCCCTCTGGGGCCACAGTGTTTT 0: 1
1: 1
2: 1
3: 17
4: 241
Right 1031497342 7:122466431-122466453 CAACATGGGGGTGGTAGGCGGGG No data
1031497329_1031497338 -1 Left 1031497329 7:122466404-122466426 CCCCTCTGGGGCCACAGTGTTTT 0: 1
1: 1
2: 1
3: 17
4: 241
Right 1031497338 7:122466426-122466448 TCCAGCAACATGGGGGTGGTAGG 0: 1
1: 0
2: 2
3: 13
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031497329 Original CRISPR AAAACACTGTGGCCCCAGAG GGG (reversed) Intronic
900937563 1:5776145-5776167 AAACCTCTGGGGCCCCATAGAGG + Intergenic
901425468 1:9179988-9180010 GGAACACTGGGGCCCCAGTGGGG + Intergenic
902925036 1:19690397-19690419 ACAACCCTGAAGCCCCAGAGGGG - Intronic
905207478 1:36351099-36351121 AAAACACTGTGGCAGCCCAGAGG - Intronic
905405995 1:37732734-37732756 GCAGCACTGTGGCTCCAGAGGGG + Intronic
905775843 1:40666620-40666642 AAAACACTGGAGCCCAAGAGTGG - Intergenic
907475883 1:54705186-54705208 AAGAAACTGAGGACCCAGAGGGG - Intronic
907802603 1:57785466-57785488 AAAACACTGTGACTCAAGGGAGG + Intronic
908330675 1:63067851-63067873 AAAAGACTGAGGCCAGAGAGAGG - Intergenic
908877585 1:68695610-68695632 AAGACACTGTGGATTCAGAGTGG + Intergenic
912593903 1:110854679-110854701 AAAACACTATGACCACAGTGAGG - Intergenic
912838929 1:113021736-113021758 TAAATACTGTGTCCCCACAGAGG + Intergenic
913157999 1:116118832-116118854 AACACACTGTGCCTCCAGAAAGG + Intronic
915273802 1:154774427-154774449 TGAAGACTGAGGCCCCAGAGGGG - Intronic
915291723 1:154888742-154888764 AGTACACTCTGGCCACAGAGTGG + Intergenic
915988378 1:160489245-160489267 AGCACACTGTGTCCCCAGATAGG + Intronic
917485793 1:175453457-175453479 AAACCTGTGTGTCCCCAGAGAGG - Intronic
919188454 1:194184781-194184803 AAAACACTCTGGATCCACAGGGG - Intergenic
920512084 1:206558902-206558924 AGAACACCGTGGCTGCAGAGGGG + Intronic
920688464 1:208127907-208127929 AAAAACCTGTGGGCACAGAGAGG - Intronic
923268700 1:232335636-232335658 AAAGCCCAGTGCCCCCAGAGAGG - Intergenic
923881110 1:238104976-238104998 TAAAGACTGTGGCCACACAGAGG + Intergenic
923886706 1:238165195-238165217 AGAGCACTTTGGCCCCACAGTGG + Intergenic
1064457771 10:15504526-15504548 AAAACACTGTGTGTTCAGAGAGG - Intergenic
1064895065 10:20226503-20226525 AAAACACTTTTGACCCAGAAAGG + Intronic
1065161643 10:22928315-22928337 ACAAAACTGAGGCCCGAGAGGGG + Intronic
1067465089 10:46491744-46491766 ACAACATTGTGGCCACAGAAGGG + Intergenic
1067552882 10:47247570-47247592 AGAACACACTGGCCCCACAGAGG + Intergenic
1067622099 10:47892857-47892879 ACAACATTGTGGCCACAGAAGGG - Intergenic
1067992314 10:51228752-51228774 AAATCACTGTGGCAGCACAGAGG - Intronic
1069725634 10:70576128-70576150 AAAAAACCCTGGCCACAGAGTGG - Intergenic
1070341812 10:75504889-75504911 AAATCACTCTGGCTACAGAGTGG + Intronic
1071255240 10:83866411-83866433 AAATCAGTGTGACCTCAGAGTGG + Intergenic
1072881695 10:99234765-99234787 ATAACGCTGTGACCCCAGCGAGG + Intronic
1073639924 10:105241389-105241411 ACAACCCTGAAGCCCCAGAGGGG + Intronic
1074127508 10:110540981-110541003 AAAACTCTGTGGCCCCTCACTGG - Intergenic
1074408154 10:113198937-113198959 AAAACAATCTGGGCCTAGAGAGG + Intergenic
1074918459 10:117982515-117982537 AAATCACTGGGGCCCAAGCGAGG + Intergenic
1075010877 10:118869247-118869269 AAATAACTGTGGCCACACAGAGG - Intergenic
1076068603 10:127468364-127468386 AAAATACTGGGGACCCAGTGGGG + Intergenic
1076755552 10:132569645-132569667 AAAACAGTGGGGACCCAGCGAGG - Intronic
1076755576 10:132569792-132569814 AAAACAGTGGGGGCCCAGTGCGG - Intronic
1076755604 10:132569940-132569962 AAAACAGTGGGGGCCCAGTGCGG - Intronic
1076755628 10:132570088-132570110 AAAACAGTGGGGGCCCAGCGCGG - Intronic
1077648428 11:3947432-3947454 AAAACTTTCTGGCTCCAGAGAGG - Intronic
1078558121 11:12347257-12347279 AAAGCACTGTGGGCACACAGGGG - Intronic
1079736873 11:24008516-24008538 AAAACACTGTTGAACCAGACCGG + Intergenic
1079995983 11:27295590-27295612 GAAAAACTGAGGCCCCAAAGGGG + Intergenic
1081579301 11:44340848-44340870 AGAAAGCTGTGGCCGCAGAGTGG - Intergenic
1081594144 11:44447539-44447561 AAACCACTGTGGCCTCAGGAGGG + Intergenic
1081622578 11:44627685-44627707 AAAACTCTGAGGTTCCAGAGAGG + Intergenic
1083621123 11:64049905-64049927 AAGACGCTGTGGCCCCGGGGGGG + Intronic
1084031375 11:66482600-66482622 AGAAGACTGAGGCTCCAGAGAGG - Intronic
1084374606 11:68767797-68767819 AAAACCCGGTGAACCCAGAGTGG - Intronic
1085523499 11:77151520-77151542 ACATCTCTGTGGCCTCAGAGAGG + Intronic
1086557938 11:88133908-88133930 GAAAAAATGAGGCCCCAGAGAGG - Intronic
1089300942 11:117498213-117498235 GACAAACTGAGGCCCCAGAGAGG - Intronic
1089466058 11:118687449-118687471 AGACCACTGTCACCCCAGAGTGG - Intergenic
1089768117 11:120783230-120783252 AAATCTCTTTGGCCACAGAGTGG + Intronic
1090192465 11:124783170-124783192 CAAAGACTGAGGCTCCAGAGAGG - Intronic
1090494502 11:127196975-127196997 CAAAAACTGTGGACCCAGAGAGG - Intergenic
1091600975 12:1917574-1917596 AAAACACAGACACCCCAGAGAGG + Intronic
1092039794 12:5374130-5374152 AAAGCACTGGGACCACAGAGCGG - Intergenic
1092615454 12:10212419-10212441 CAAACACTGTGACGCCAGCGCGG + Intergenic
1098569476 12:71972651-71972673 TAAATACTGTGGCTACAGAGAGG + Exonic
1101192364 12:102348196-102348218 GAATCACTGTGGCAGCAGAGAGG + Intergenic
1102202108 12:111064323-111064345 AGAAAACTGAGGCCACAGAGGGG - Intronic
1103983544 12:124752157-124752179 AAAACACCGTGGCCGCGGGGCGG + Intergenic
1104195494 12:126533297-126533319 GAAACACTGAAACCCCAGAGAGG - Intergenic
1106518745 13:30477857-30477879 AAAACACTGAGTGCCCAAAGCGG + Intronic
1107260308 13:38482446-38482468 AAAAGACTGAGGCCCCTAAGAGG - Intergenic
1108603095 13:52011671-52011693 AGAACACTGTGGCACCGGCGGGG - Intergenic
1110788959 13:79566478-79566500 AACACACAGTGGCCGAAGAGAGG + Intergenic
1114547154 14:23511653-23511675 AGAACACTCTGGGCTCAGAGGGG - Intergenic
1116572860 14:46539841-46539863 AAACCAATGTGTCCCAAGAGAGG - Intergenic
1117508575 14:56426455-56426477 GAAACATTGTAGCCCCAGAATGG + Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1119670501 14:76514631-76514653 AGACCACTGTTGGCCCAGAGAGG - Intergenic
1120061775 14:79992023-79992045 AAAACACAGTGGCCTATGAGAGG + Intergenic
1121009360 14:90510873-90510895 AAATCAAAGTGGCCTCAGAGAGG - Intergenic
1121471551 14:94158936-94158958 AAGACACTGTGTCCCATGAGTGG - Intronic
1122500086 14:102191577-102191599 AAAAAGCTCTGGCCCAAGAGTGG + Intronic
1122793014 14:104192379-104192401 AACCCAGTGTGGCCCCAGGGTGG - Intergenic
1123808152 15:23896666-23896688 GAAACAGTGTGGCCCATGAGAGG + Intergenic
1124353090 15:28973485-28973507 AAAACACTGTTGTCACATAGAGG + Intronic
1125844760 15:42841622-42841644 AAAACACTGTGGCGGCAATGAGG + Intronic
1131545802 15:93314635-93314657 AAATCACTGTGGCTGCAGTGGGG + Intergenic
1131569061 15:93514877-93514899 TAACCACTATGGCCCCAAAGGGG + Intergenic
1132925679 16:2428202-2428224 AAGAGTCCGTGGCCCCAGAGAGG - Intergenic
1135409602 16:22223486-22223508 AAAACACTCTGGCACCAGCCTGG - Intronic
1136057160 16:27698944-27698966 AAACCCCTGTAGGCCCAGAGAGG - Intronic
1136283462 16:29228070-29228092 CAAACACTCAGGCCCCAGCGTGG + Intergenic
1138276654 16:55740079-55740101 AAACAACTGTGGACACAGAGAGG + Intergenic
1138526050 16:57607866-57607888 AGCACACGGTGGCCCCTGAGAGG + Intergenic
1139147888 16:64344878-64344900 AAAGCAGTGTGGACCCAAAGAGG - Intergenic
1140521486 16:75585691-75585713 GAAACACACTGGCCCCAAAGAGG + Intergenic
1141471020 16:84238549-84238571 AAAAGCCTGCGGGCCCAGAGAGG - Intronic
1141531993 16:84652883-84652905 CAGACACTGTGGCCACACAGTGG - Intronic
1143346724 17:6254989-6255011 GAAACACAGTGACCACAGAGGGG + Intergenic
1143953779 17:10653492-10653514 ATAACACTCTGACCCCAGAAAGG - Intronic
1143976197 17:10831764-10831786 CAAGGACTGAGGCCCCAGAGAGG + Intronic
1144704944 17:17362217-17362239 AAAACAGTGTGGGGCCAGAGAGG - Intergenic
1146163576 17:30572344-30572366 AAGAAACTGGGGCTCCAGAGGGG + Intergenic
1147137262 17:38441525-38441547 AGGAAACTGAGGCCCCAGAGAGG + Intronic
1148789557 17:50165840-50165862 AAAACACTGTGGCCACTGGAGGG + Intronic
1154263357 18:12857210-12857232 AGGAGACTGTGGCCCCAGAAAGG + Intronic
1154517068 18:15182703-15182725 AATACAATGTGGTCCCAGAATGG + Intergenic
1160519780 18:79498186-79498208 AAAAATCTGTAGCCCCTGAGAGG + Intronic
1162947448 19:14052381-14052403 AAGACACTGAGGACTCAGAGAGG + Exonic
1164970753 19:32530650-32530672 AAAAGACAGTGGACCCAGGGAGG - Intergenic
1165718725 19:38063742-38063764 GGAACACTGGGGCCCCACAGGGG - Intronic
1165996631 19:39848525-39848547 CAAACAGTGTTGGCCCAGAGGGG + Intergenic
1167826688 19:51979679-51979701 AAGACACTGGGTCCACAGAGTGG - Intronic
927191839 2:20522394-20522416 CACACACTGGGGCCCCTGAGTGG - Intergenic
928916546 2:36477932-36477954 ACAACACTGTTTCCCCAGAAAGG + Intronic
928963880 2:36957599-36957621 AAAATAAAGTGGCCCCAGACTGG + Intronic
929601733 2:43208679-43208701 AAGACACTGTGGCCCTTCAGGGG - Intergenic
931009287 2:57889700-57889722 AAAGCACTGTGCCCAAAGAGAGG - Intergenic
931381796 2:61760767-61760789 GAAGTCCTGTGGCCCCAGAGGGG - Intergenic
932440893 2:71734195-71734217 CAAACACTGGAGCCCAAGAGTGG - Intergenic
933342954 2:81046336-81046358 AAAACCGTATGGTCCCAGAGTGG + Intergenic
934566174 2:95342790-95342812 CAATCACTGTGGCAGCAGAGGGG + Intronic
937524346 2:122748652-122748674 AAAAAAGTGTGGCCACACAGAGG - Intergenic
940161059 2:150714033-150714055 ACATCAATGTGGCCCCAGAGTGG - Intergenic
941202951 2:162536959-162536981 AAAACGCTGCCACCCCAGAGAGG - Exonic
941288283 2:163642567-163642589 AAAACACTGTGGACTCTCAGAGG + Intronic
941506145 2:166348079-166348101 AACAATCTGTGGCTCCAGAGAGG + Intronic
942295498 2:174513099-174513121 AAAACATGCTGGCCCTAGAGGGG - Intergenic
942496300 2:176543213-176543235 CAATCACTGTGGCCAAAGAGAGG + Intergenic
944252338 2:197590860-197590882 AAGACAGTGTGGACCCAAAGAGG + Intronic
945892384 2:215443350-215443372 AAAGCACTGTTACCCCAGTGTGG - Intergenic
946053562 2:216882938-216882960 ATAAGGCTGTGGCCCAAGAGGGG - Intergenic
947519123 2:230830216-230830238 AAAACACGGTGGCCCAAGCAGGG - Intergenic
948795792 2:240401506-240401528 GAAACCCTGTGCCCACAGAGCGG + Intergenic
1169263936 20:4156423-4156445 AAGAAACTGAGGCCTCAGAGGGG - Intronic
1169276413 20:4236226-4236248 AGAAAACTGAGGCACCAGAGAGG - Intronic
1171519222 20:25763508-25763530 AAAATATTGGGGCCCCAGAAGGG + Intronic
1172027012 20:31955416-31955438 AAAACTGTGGGGGCCCAGAGAGG - Intergenic
1172151033 20:32790534-32790556 AAAACACTGTGGCTCTGGTGGGG - Intronic
1174325426 20:49775080-49775102 CAAACACTGGGGCCAGAGAGAGG + Intergenic
1178704904 21:34865020-34865042 ACAAAGCTGAGGCCCCAGAGAGG - Intronic
1179803699 21:43824263-43824285 GATAAACTGTGGCCCCACAGAGG + Intergenic
1181349368 22:22244373-22244395 AAGACACTGGGGGCCCAGAGCGG - Intergenic
1181961920 22:26628419-26628441 AATACACTTACGCCCCAGAGTGG - Exonic
1182873038 22:33665175-33665197 GAAACACTGTGGCCTCAGGATGG - Intronic
1184422248 22:44389091-44389113 GAAACACTCTGGCCCCAGAGTGG + Intergenic
950932585 3:16805385-16805407 AAGACACTGTGGCCACCAAGAGG + Intronic
951400753 3:22229381-22229403 AAAACCCTGTGGCACCTGGGAGG - Intronic
952080388 3:29751398-29751420 AAAACCCTGTGGCAACATAGGGG + Intronic
952593797 3:34989439-34989461 AAAGCAGTGTGGACCCAAAGAGG - Intergenic
952973356 3:38671391-38671413 AAAATCCTGTATCCCCAGAGGGG - Intergenic
952985857 3:38782346-38782368 AAACCACGGTGCCTCCAGAGGGG - Intronic
953025083 3:39140410-39140432 AGAACCCTGTGGCCCTAGATGGG + Intergenic
953202839 3:40792700-40792722 AAGACAGTGTGGCCGCAGAAAGG - Intergenic
954133864 3:48573133-48573155 AAAACACGGTGTCCCTACAGGGG + Intronic
955233051 3:57115828-57115850 AAAACACCCTGGCTTCAGAGGGG - Intronic
956036296 3:65095687-65095709 AAAACCCTGAGGACCTAGAGAGG + Intergenic
958116498 3:89225905-89225927 AGAAGACTGTGGTCCCACAGTGG - Intronic
958124108 3:89333249-89333271 TAAACACTGTGGGCCCATATGGG - Intronic
958509335 3:95025605-95025627 AAAATACTATGCCCACAGAGAGG - Intergenic
959071559 3:101706558-101706580 AAAACATCGTGGGCCCAGTGTGG + Intergenic
961389606 3:126544483-126544505 CAAAGACAGTGGCCCCAGTGTGG - Intronic
961632277 3:128309832-128309854 GGAACTCTGAGGCCCCAGAGTGG - Intronic
962380464 3:134894332-134894354 AGAAAACTGAGGCCCAAGAGAGG - Intronic
962841001 3:139232525-139232547 AAGAAACTGTGGTCTCAGAGAGG - Intronic
963593201 3:147289034-147289056 GAAACACTGTGGCAACAGTGAGG + Intergenic
967469072 3:189842014-189842036 AAACCAGTTTGGGCCCAGAGGGG + Intronic
967976879 3:195040489-195040511 AGGACACTGAGGCCTCAGAGGGG + Intergenic
968441087 4:624941-624963 AAAGCCATGTGGCCTCAGAGCGG + Intergenic
968947553 4:3673401-3673423 AGACCACGGTGCCCCCAGAGTGG - Intergenic
970271726 4:14355232-14355254 AACACACTTTGGAACCAGAGAGG + Intergenic
970537556 4:17044700-17044722 AAACCACTGTGGTCCCCAAGAGG + Intergenic
971091265 4:23348407-23348429 CAAAGACTGTGGCCTGAGAGAGG - Intergenic
971384159 4:26127802-26127824 AAATCATTGTGGCCCTAAAGAGG + Intergenic
972583506 4:40416025-40416047 AGATCACTGTGGCCCCAGTGTGG + Intergenic
973998183 4:56481473-56481495 ATAACACTGTGCCCCCACATGGG + Intronic
975442524 4:74428352-74428374 AATACATTGTGGCTACAGAGTGG - Intergenic
976222443 4:82768329-82768351 AAAACACTGTTGCCTGACAGAGG + Intronic
978100431 4:104833206-104833228 AAATCACTCTGGCTTCAGAGAGG + Intergenic
978300356 4:107262713-107262735 AGAAAACTATGGCACCAGAGAGG + Intronic
981844920 4:149156463-149156485 AAAACACAGTGGCCCCTGATAGG + Intergenic
986041748 5:4000397-4000419 AAAACATTGTGGTCAGAGAGTGG + Intergenic
986324880 5:6664961-6664983 AAAACACTGTGGGCCAGGAATGG + Intronic
986936763 5:12898011-12898033 AAAAAAATGTGGCACCAGGGAGG - Intergenic
988484293 5:31655694-31655716 TAAACACTGATGCCCCAGGGAGG + Intronic
990284663 5:54289071-54289093 AAACCACTGATGCCCCAGGGTGG + Intronic
990906303 5:60806989-60807011 AAAACGCTGTGGCCCAGGAAAGG + Intronic
990976646 5:61566644-61566666 AAGAAACTGGGGACCCAGAGTGG - Intergenic
991024311 5:62013812-62013834 AAAATACAGTGGTCTCAGAGAGG - Intergenic
992189538 5:74277488-74277510 AAAACACAGTTTCCCTAGAGAGG - Intergenic
992762393 5:79962224-79962246 AACAAACTGTAACCCCAGAGTGG - Intergenic
993761674 5:91803111-91803133 ACAACCCTGAAGCCCCAGAGAGG - Intergenic
994041497 5:95264611-95264633 CAAACACTGTGGGCTGAGAGTGG - Intronic
995064590 5:107845709-107845731 AGGAGACAGTGGCCCCAGAGAGG + Intergenic
996262234 5:121486346-121486368 CACACACTGGGGCCTCAGAGAGG + Intergenic
997894321 5:137702642-137702664 AAATCACTGTAGCCACAGTGTGG + Intronic
999209057 5:149871773-149871795 AAATCACTGTGGCTTCAGTGTGG + Intronic
999442840 5:151615690-151615712 AAAACTCTGTGGCCCCAGAGAGG + Intergenic
999463467 5:151777621-151777643 AAAAGACTGAGGCAGCAGAGAGG + Intronic
1002269101 5:178058063-178058085 ACAACAGTGTGGACCCAGCGGGG - Intergenic
1003592234 6:7445961-7445983 AAAACACGGTGTCCCCAAACTGG + Intergenic
1003992371 6:11498794-11498816 AAAACACTCATGCTCCAGAGAGG - Intergenic
1006002413 6:30975625-30975647 AAAACACTGTGGGCCAGGTGCGG - Intergenic
1006749095 6:36365478-36365500 AGAAACCTGAGGCCCCAGAGAGG + Intronic
1006936971 6:37725405-37725427 AAGACACTGAGGACCCAGACTGG + Intergenic
1007496728 6:42265033-42265055 GAAAAACTGAGGCTCCAGAGTGG + Intronic
1012262988 6:97109984-97110006 AAAACACTGTGGGCAAAGAGTGG + Intronic
1013765646 6:113571638-113571660 AAACCTTTGGGGCCCCAGAGTGG - Intergenic
1015296112 6:131595112-131595134 CAAACACTTTGTTCCCAGAGTGG + Intronic
1015597600 6:134880573-134880595 AAGAGGCTGTGGCCCCAGACAGG - Intergenic
1015645385 6:135381715-135381737 AAAACACTGTGGCAGCACAGAGG - Intronic
1016103158 6:140128283-140128305 AAGTGACTGTGTCCCCAGAGTGG + Intergenic
1017630663 6:156393350-156393372 TCAACACTGTCTCCCCAGAGAGG + Intergenic
1018519411 6:164630068-164630090 AAAACACTGTGCCACAAGAGGGG - Intergenic
1021617978 7:22522053-22522075 GAAACACAGAGGCCCAAGAGTGG + Intronic
1022927567 7:35071533-35071555 GAAACACAGAGGCCCAAGAGTGG + Intergenic
1027410826 7:77915683-77915705 AAAGAACTCTGGCCCGAGAGTGG - Intronic
1027698551 7:81439625-81439647 AGAACATTTTAGCCCCAGAGAGG - Intergenic
1028374705 7:90134055-90134077 GAAACACAGAGGCCCAAGAGTGG - Intergenic
1028970936 7:96858326-96858348 AAAGCACTGTGGTCCCACAGCGG + Intergenic
1029230203 7:99060616-99060638 AAAACACATTGGACCCAAAGTGG - Exonic
1030606045 7:111640207-111640229 AATGCACTGTGACCCCAGAAAGG + Intergenic
1031311194 7:120199575-120199597 AAAACACTGGGGCTCTTGAGTGG - Intergenic
1031497329 7:122466404-122466426 AAAACACTGTGGCCCCAGAGGGG - Intronic
1034030100 7:147752269-147752291 AAAAAAGTGTGGCCCCAAACAGG - Intronic
1035357017 7:158282042-158282064 AGAACACTGTGTTCCCAGAAGGG + Intronic
1038729586 8:30115071-30115093 TAAATACTGTGGCCCAGGAGTGG + Intronic
1039442884 8:37607762-37607784 AATTCACTGTGGCCCCTCAGGGG + Intergenic
1039567471 8:38561449-38561471 AAATCACTGTGGCCTCGGTGTGG - Intergenic
1041566466 8:59284702-59284724 ATAACAGGGTGGCCCCAGAGTGG + Intergenic
1043523243 8:81069134-81069156 GAAAGACTGTGGCCTCAGAGGGG + Intronic
1045202300 8:99996355-99996377 AAAACAGTGTGTCCTCAGTGAGG + Intronic
1049559503 8:143301985-143302007 AAGTCACTGTGGCTCCAGAGTGG - Intergenic
1049658438 8:143809091-143809113 TAAACAGTGTGGCCACAGACGGG + Intronic
1050377149 9:4985168-4985190 AAGACGGTGTGGCCCCGGAGAGG + Intronic
1051682190 9:19618574-19618596 AAAAATCTGTGACCCAAGAGTGG - Intronic
1053656384 9:40221985-40222007 CAACCACTATGGCCCCTGAGCGG + Intergenic
1053906733 9:42851203-42851225 CAACCACTATGGCCCCTGAGCGG + Intergenic
1054368490 9:64368207-64368229 CAACCACTATGGCCCCTGAGCGG + Intergenic
1054528233 9:66154300-66154322 CAACCACTATGGCCCCTGAGCGG - Intergenic
1054676113 9:67857959-67857981 CAACCACTATGGCCCCTGAGCGG + Intergenic
1055035428 9:71813153-71813175 AAAACACTGTGGCCACCCACAGG + Intronic
1056923577 9:90813462-90813484 CAACCACTCTGCCCCCAGAGAGG - Intronic
1057057796 9:91977345-91977367 TAAACGCTGTGTCCCCAGAGGGG - Intergenic
1057172402 9:92970874-92970896 AAAAGCCTTTGGCCGCAGAGGGG + Intronic
1059395184 9:114029814-114029836 AAAGGACTCTGGCTCCAGAGGGG + Intronic
1061605815 9:131709872-131709894 AAATCCCTTTGGCCCCAGGGAGG + Intronic
1185848718 X:3465124-3465146 AAAACACTCTGGCTCCAAAGTGG + Intergenic
1185981547 X:4785376-4785398 ACAACACTGTAGCCGCAGAAAGG - Intergenic
1186709181 X:12174685-12174707 CAAACACAGAGACCCCAGAGAGG + Intronic
1187172264 X:16863639-16863661 AAGAAACTGAGGCCCCAGGGAGG - Intronic
1188524558 X:31075119-31075141 AGAACACTGTAGCCACAGTGGGG + Intergenic
1189458985 X:41221742-41221764 AGAGCACTGTGGCCACAGTGTGG + Intronic
1195082485 X:101384821-101384843 AAATAACTGAGGCTCCAGAGAGG + Intronic
1195814608 X:108870995-108871017 TCAACACTGAGGCCCCTGAGGGG - Intergenic
1195831227 X:109061082-109061104 ACAACAATGTTGCTCCAGAGAGG - Intergenic
1197873080 X:131078500-131078522 AAAACACTTTGGAGCAAGAGAGG + Intronic
1198444049 X:136693871-136693893 AAATCACTGTGGTCCAAAAGGGG + Intronic
1199621329 X:149704333-149704355 AGAACACTGGGGATCCAGAGGGG + Intronic
1199793106 X:151173357-151173379 AGAAAACTGAGGCCCCAGAGAGG - Intergenic
1199866971 X:151860658-151860680 AAAGCACTGTGTCCACAGAAGGG + Intergenic