ID: 1031509267

View in Genome Browser
Species Human (GRCh38)
Location 7:122628037-122628059
Sequence TACAGTGTGCTATAAATTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031509267_1031509271 24 Left 1031509267 7:122628037-122628059 CCCCTAATTTATAGCACACTGTA 0: 1
1: 0
2: 0
3: 9
4: 145
Right 1031509271 7:122628084-122628106 CTCATGATCTAATTCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031509267 Original CRISPR TACAGTGTGCTATAAATTAG GGG (reversed) Intronic
903521130 1:23950749-23950771 TACAGTATGCTCTAAATGGGAGG - Intergenic
906445421 1:45892852-45892874 TACAGTTTGCTATAAGTTTTTGG - Intronic
908767333 1:67565917-67565939 TACAGGCTCCTTTAAATTAGGGG + Intergenic
909343831 1:74562060-74562082 TACAGTGTACTTTAAAGCAGTGG + Intergenic
910580751 1:88821785-88821807 CACATTGTGCTAGATATTAGGGG - Intronic
911849270 1:102795657-102795679 TCCAGTTCGATATAAATTAGAGG + Intergenic
912081180 1:105938327-105938349 TGCAGTTTTCTATAAATTGGGGG + Intergenic
924340525 1:243026038-243026060 TACACTTTGCTATAAAGGAGTGG + Intergenic
1064800865 10:19070367-19070389 TACAATATGCAATAAATTACAGG - Intronic
1069244048 10:66179822-66179844 TACAATGTTCTATATATGAGAGG + Intronic
1070229442 10:74549333-74549355 AAGAGTGTTCTATAAATTCGAGG - Intronic
1072102752 10:92245059-92245081 TACAGTATGCTGCAAATCAGTGG - Intronic
1072155137 10:92717035-92717057 CACACTCTGATATAAATTAGCGG - Intergenic
1073027773 10:100500760-100500782 TTCAGTGTGGAATAAATTAAGGG - Intronic
1074004109 10:109402220-109402242 TACAGAGGTCTGTAAATTAGTGG + Intergenic
1074457259 10:113605934-113605956 AACACTGTGCTATAAATGAAAGG - Intronic
1074655150 10:115577818-115577840 TACATTGTACCATATATTAGAGG + Intronic
1074928825 10:118102865-118102887 TAAAGTGCCCTATAAATAAGAGG + Intergenic
1079207061 11:18425155-18425177 GACAATGTTCTATAAATTTGGGG + Intronic
1080558990 11:33444884-33444906 TACAGAGAGCTATAAAGCAGTGG - Intergenic
1088871889 11:113897405-113897427 TACAGTGAGCCATAGATCAGGGG + Intergenic
1092746905 12:11681252-11681274 TACAGTGTACTACAGATTTGGGG + Intronic
1092761095 12:11812067-11812089 TACAGTGTTCTATAAATTTTAGG - Intronic
1092841355 12:12544979-12545001 TACAGTGTGGAATAAATGAATGG - Intronic
1095764517 12:45879983-45880005 TACAGTGTTCTTTGAATAAGTGG + Intronic
1096300401 12:50422265-50422287 TACATTGTTCTAAAAAGTAGGGG + Intronic
1097597494 12:61652563-61652585 AACAGGGTGCTTTAAATTGGGGG + Intergenic
1099171679 12:79372110-79372132 TACAGTGTGTGATAAATCATGGG - Intronic
1099407036 12:82276873-82276895 TTCAGTGTGCCAAAAAGTAGTGG - Intronic
1099642038 12:85302319-85302341 TTCAGTGTAGTATTAATTAGTGG - Intergenic
1103926335 12:124425531-124425553 GACAGTGTGCTATAATTCCGGGG - Intronic
1104325373 12:127790955-127790977 TACAGTGAGCTTTAAATGACTGG + Intergenic
1104431145 12:128717409-128717431 CACAGTGTGGCATAAATTAGGGG - Intergenic
1104813188 12:131630558-131630580 TGCAGTGTTCAATAAATTACAGG - Intergenic
1105846012 13:24294552-24294574 TACAGTCTGCCATAGATTAAGGG - Intronic
1108168880 13:47720949-47720971 TACAGTGAACTTTAAATTATCGG + Intergenic
1110550429 13:76805737-76805759 TACAATTTGCTATGAATAAGAGG + Intergenic
1110937164 13:81305465-81305487 TATACTTGGCTATAAATTAGGGG - Intergenic
1110973067 13:81791725-81791747 AAAAGTGTGCTATATATTTGTGG + Intergenic
1111445547 13:88342654-88342676 TAAAGAATGCCATAAATTAGAGG + Intergenic
1112299199 13:98214681-98214703 TGCAGTGCGCAATAAATTGGTGG - Intronic
1114362106 14:21985503-21985525 TACTGTGTCCCATAAATAAGAGG - Intergenic
1114714463 14:24809851-24809873 TACAGGATGCTCTAAATAAGGGG - Exonic
1116682585 14:47993006-47993028 TACAGTTTACTATGATTTAGAGG + Intergenic
1119797774 14:77414776-77414798 TACAGTATGCTGTATAATAGTGG - Intronic
1125924078 15:43547838-43547860 TACAGTTCCCTATGAATTAGAGG + Intronic
1127093964 15:55494385-55494407 TTCATTGTGATATAAATTAGTGG + Intronic
1127095362 15:55507433-55507455 TACAGTATTCAATAAATTACAGG - Intronic
1128444476 15:67745395-67745417 TTTAATGTGCTATAAACTAGGGG + Intronic
1138797616 16:59989009-59989031 TTCAGTGCCCTATAAATTAAAGG + Intergenic
1138910685 16:61394643-61394665 TCCAGTGAGTTATAAATTAATGG - Intergenic
1139106302 16:63830820-63830842 TAGAGTGTGCTGAAAATTAAGGG + Intergenic
1141635579 16:85312269-85312291 GACAGTGTGCCACAAATTGGCGG + Intergenic
1148171154 17:45521437-45521459 AACAGAGAGCAATAAATTAGCGG + Intergenic
1148278518 17:46328358-46328380 AACAGAGAGCAATAAATTAGCGG - Intronic
1148300728 17:46546221-46546243 AACAGAGAGCAATAAATTAGCGG - Intronic
1148364866 17:47047112-47047134 AACAGAGAGCAATAAATTAGCGG - Intronic
1149006133 17:51807504-51807526 TTAAGTGTTCTACAAATTAGTGG - Intronic
1149684946 17:58529929-58529951 TACAGGTTGCTATAAGTCAGAGG - Intronic
1149688999 17:58557931-58557953 AACAGTCTACTCTAAATTAGAGG - Intronic
1149813289 17:59698817-59698839 TACAGTATTCAATAAATTACAGG - Exonic
1150401773 17:64863030-64863052 AACAGAGAGCAATAAATTAGCGG + Intronic
1155550061 18:26955281-26955303 TACAGTGTGCTCCAAATTATGGG + Intronic
1157271870 18:46282472-46282494 TCCAGTGTGCATTAAAGTAGGGG + Intergenic
1157344417 18:46811627-46811649 TAGAGTTTTCTATAAATTTGAGG - Exonic
1157660402 18:49436602-49436624 TACAGTGTGCTATTTATCAGGGG + Intronic
1159104374 18:63988856-63988878 TAAAGTGTTCTTCAAATTAGAGG - Exonic
1168654127 19:58114681-58114703 TATAGTGTGTTATATATTACAGG + Intronic
924987611 2:286833-286855 TTCAGTGAGGTGTAAATTAGTGG + Intronic
926761128 2:16280122-16280144 TAAAATGTGTTCTAAATTAGTGG + Intergenic
933543414 2:83678254-83678276 TATATTGTTCCATAAATTAGAGG - Intergenic
941949222 2:171135811-171135833 TACATTTTGCTAATAATTAGTGG - Intronic
942211085 2:173670994-173671016 TACACTGTGCCAAAACTTAGTGG + Intergenic
944889672 2:204104216-204104238 TACACTATGCTATATATCAGTGG + Intergenic
945100510 2:206258486-206258508 AACAGTGGGATATAAATTATGGG - Intergenic
945646949 2:212508423-212508445 TGCATTGTGTTATAATTTAGAGG + Intronic
1168742939 20:210036-210058 TACAGTATTCAATAAATTACAGG - Intergenic
1172265077 20:33604752-33604774 TACAGTGTGCAACAACCTAGAGG - Intronic
1174463796 20:50701679-50701701 AACAGTGTGCTGGAAATTTGTGG - Intergenic
1176692811 21:9937616-9937638 AGCAGTGTGCCATAATTTAGAGG - Intergenic
1177326518 21:19597019-19597041 TGCAGTATGCTATATCTTAGGGG + Intergenic
950294398 3:11816195-11816217 TACAGTGTTCTTTACATTAAAGG + Intronic
950795848 3:15510279-15510301 TACAGTTTGCTCTCAATTACTGG - Intronic
956079005 3:65537404-65537426 TACAAGGTGCCATAAATTATGGG - Intronic
958843488 3:99237460-99237482 TACAGTATTCAATAAATTATAGG - Intergenic
960416600 3:117392672-117392694 TACATGGTGCTATCAATGAGTGG + Intergenic
960728379 3:120695321-120695343 CACAGAGTACTAGAAATTAGGGG + Intronic
967809435 3:193744546-193744568 GACTGTGTGCTAGAAATTAGAGG + Intergenic
970055712 4:11969798-11969820 TTCACTGAGCTATAGATTAGTGG - Intergenic
973657545 4:53064755-53064777 TCCAGAGTGTTATAAATTGGTGG - Intronic
975442496 4:74427870-74427892 TAAATTGTGCTACAAATTAATGG + Intergenic
976981474 4:91236539-91236561 TGCAGTGTTCTATAATTTTGAGG + Intronic
977363706 4:96039323-96039345 TACAGTGTGATTTATTTTAGTGG - Intergenic
978582183 4:110243231-110243253 AACAGTGTGGCATAAATAAGAGG + Intergenic
979481336 4:121221608-121221630 TACAGTGTGGAAGAAATTGGAGG + Intronic
979733835 4:124057088-124057110 TACAATAAGGTATAAATTAGGGG - Intergenic
980650871 4:135713350-135713372 TATAGTGTGGTATAAAATAAGGG - Intergenic
981583599 4:146275206-146275228 AACAATGTGCTATAATTTTGAGG + Intronic
983142127 4:164163764-164163786 TATAGTTTGGTATTAATTAGTGG - Intronic
983689318 4:170449163-170449185 TACAGTATTCAATAAATTACAGG - Intergenic
990688010 5:58329652-58329674 TACTGGGTGCTATTAACTAGTGG + Intergenic
992053436 5:72963096-72963118 TACAGTGTGTGATAAAGTTGAGG + Intronic
992343382 5:75849484-75849506 AACAGTGTGGTATACATTTGTGG + Intergenic
993318880 5:86446829-86446851 CACAGTGTTCAATAAATCAGAGG - Intergenic
997243361 5:132324916-132324938 TACAGTGGGCTAGAAATGGGAGG + Intronic
997879813 5:137579528-137579550 TACAGGGCACTATAATTTAGTGG + Intronic
997934424 5:138098028-138098050 GACAGAGTGGTATAAATTAAGGG - Intergenic
998750643 5:145318088-145318110 TAAAATGTACTATAAATTTGAGG - Intergenic
999456248 5:151718839-151718861 TACAGTTTGCTAAAAGTTGGAGG - Intergenic
1002987531 6:2205398-2205420 GACAGTGTGCTTTGGATTAGAGG - Intronic
1003814041 6:9817344-9817366 TTCAGTGTTCTACAAATTATGGG - Intronic
1005098483 6:22144246-22144268 TGCAGTGAGCTATAAAATATCGG - Intergenic
1007104960 6:39277288-39277310 TACACTGTAGTATGAATTAGTGG - Intergenic
1007820218 6:44555448-44555470 GACACTGTGCTAAATATTAGGGG + Intergenic
1007877002 6:45115122-45115144 TACAGTTTGCTTTAAATGATAGG - Intronic
1008928603 6:56913624-56913646 TACAGGGTGCTATAGAGCAGGGG - Intronic
1019064378 6:169284456-169284478 TACAGTGTGCTACTATTTATGGG - Intergenic
1021372844 7:19871497-19871519 TACAGTGCCCTCTACATTAGGGG + Intergenic
1021638161 7:22711660-22711682 TACAGAGTGCTCTAAAATATGGG - Intergenic
1022446542 7:30475421-30475443 TACAGTGCTCTATAATTTAGAGG + Intronic
1027357388 7:77371252-77371274 GATAATTTGCTATAAATTAGAGG - Intronic
1028205606 7:88013154-88013176 TACTGGATGCTATAAATTGGTGG - Intronic
1028704767 7:93828636-93828658 TACAGTATTCAATAAATTACAGG + Intronic
1029335457 7:99895531-99895553 TAGAGTGTTCTATAAATAATGGG + Intronic
1029861070 7:103572766-103572788 TACAGTCTGTTATAATTTAATGG + Intronic
1031364102 7:120883240-120883262 AACAGTGTGTTATAATTTATAGG - Intergenic
1031509267 7:122628037-122628059 TACAGTGTGCTATAAATTAGGGG - Intronic
1035702251 8:1645302-1645324 TACAGTGTTCCATGAATTCGAGG + Intronic
1038807142 8:30804696-30804718 TTCAGTGAACTATAAATTACAGG - Intronic
1038959862 8:32506976-32506998 TACATTGTTCAATAAATTAATGG - Intronic
1040834117 8:51714025-51714047 TTCAGTGTGATAAAAATTACCGG - Intronic
1040928320 8:52708739-52708761 TACAGTCAGCTATAAATGAAGGG + Intronic
1041579318 8:59439191-59439213 TATAGTGTATTATAAATTATAGG + Intergenic
1042779371 8:72473599-72473621 TACAGTAGGCAATAAACTAGGGG + Intergenic
1043813833 8:84777243-84777265 TACAGGGAGCTATAATCTAGTGG - Intronic
1044490470 8:92808123-92808145 TACAGTCTGCTATAAACACGTGG + Intergenic
1045590563 8:103590057-103590079 TACAGTTTGAAATAACTTAGAGG + Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1048807774 8:138256381-138256403 TACAATGTGATAGAAATTGGGGG - Intronic
1048853175 8:138663681-138663703 TACAGTATGCTTTAAATAAAGGG - Intronic
1050726211 9:8652100-8652122 TACCCTGAGCTGTAAATTAGAGG - Intronic
1055155371 9:73056726-73056748 TAAAGTGTGATGTAAATCAGGGG + Intronic
1055268262 9:74524548-74524570 TACATTCTTCTATAAATTAGTGG - Intronic
1059785279 9:117575523-117575545 TACACCATGCTATAAGTTAGGGG + Intergenic
1059923538 9:119184502-119184524 TAAATTGTCCTATAAATAAGAGG - Intronic
1185825623 X:3246436-3246458 TACAGTGGGCTTTAAATGATGGG + Intergenic
1187347195 X:18476717-18476739 TACATTCAGCTATAAATAAGTGG - Intronic
1188026871 X:25219110-25219132 TACATTCTGCTATTTATTAGCGG - Intergenic
1188223613 X:27570546-27570568 TGCAGTGTCCTGTAAATTACTGG + Intergenic
1188533944 X:31174173-31174195 TATTTTGTGCTAGAAATTAGTGG - Intronic
1191949969 X:66579597-66579619 TACTGTTTGCTAGAAATTATTGG + Intergenic
1194749206 X:97665775-97665797 TGCAGTGTACTCTAAATTAGTGG + Intergenic
1196938648 X:120754069-120754091 TTCAGTGTGCTATGATTAAGAGG - Intergenic
1198686050 X:139229177-139229199 TACAGATTGCTCTAAATGAGAGG - Intergenic
1199249909 X:145648908-145648930 TACAATGTGCTAGCCATTAGAGG - Intergenic