ID: 1031513629

View in Genome Browser
Species Human (GRCh38)
Location 7:122677015-122677037
Sequence GAATGTACGCAGAGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031513629 Original CRISPR GAATGTACGCAGAGTGTGGA GGG (reversed) Intronic
900585711 1:3431330-3431352 GGCTGGAAGCAGAGTGTGGAGGG + Intronic
900867341 1:5277736-5277758 GAACCAACGCAGTGTGTGGATGG + Intergenic
900972643 1:6000059-6000081 GAGTGCAGGCAGGGTGTGGACGG - Intronic
903703253 1:25266765-25266787 GAAAGAACACAGAGGGTGGAGGG - Intronic
904209715 1:28878900-28878922 GAATGTATCCAGGCTGTGGAGGG - Intergenic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
907046921 1:51305175-51305197 GAAGGTACCCAGAGTGGGCAGGG + Intronic
907106682 1:51889305-51889327 GAATCCAAGCAGAGTGAGGAGGG + Intergenic
908704388 1:66935375-66935397 GACTGTACACAGAGTATGAATGG - Intronic
909916313 1:81324016-81324038 GAATTTAAGCAGAGTGAGGCAGG + Intronic
915943229 1:160132198-160132220 GACTGTACGGAGCGTGTGTAGGG + Intronic
920100789 1:203515795-203515817 GAATGCAAGCAGAGTGGGGTGGG + Intergenic
921397756 1:214686861-214686883 GAATGTTAGGAGAGTCTGGAGGG + Intergenic
1064478549 10:15718224-15718246 TAGTGCAGGCAGAGTGTGGATGG - Intronic
1066197626 10:33116473-33116495 GACTGCAGCCAGAGTGTGGAAGG - Intergenic
1076272113 10:129162859-129162881 GAATGCACGCAGGGTGTGCAGGG + Intergenic
1079288819 11:19167212-19167234 GAATGTAACAAGAGGGTGGATGG - Intronic
1079553978 11:21736990-21737012 GAATAAACAAAGAGTGTGGATGG - Intergenic
1080612853 11:33919839-33919861 GAATGCACGCAGAGTGGCTAGGG + Intergenic
1086859905 11:91913610-91913632 GCATGTAAGCTGAGTGAGGAAGG + Intergenic
1089062517 11:115637366-115637388 TGGTGTAGGCAGAGTGTGGATGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089606542 11:119644730-119644752 CATTGTAGGCAGAGTGAGGAGGG + Intronic
1090384591 11:126349373-126349395 GAATGTAGGCCAAGTGTTGAGGG - Intergenic
1090541136 11:127707323-127707345 GAATGAAAGAAGAGTGTGGAAGG - Intergenic
1092148661 12:6232224-6232246 GAAGTTAGCCAGAGTGTGGAAGG + Intronic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1098871255 12:75819747-75819769 GACTGTACGCAGAGGGTGACTGG - Intergenic
1102489364 12:113280030-113280052 GCATGCACGAAGAGTGTGGTAGG + Intronic
1104162758 12:126195959-126195981 GAATGCATGCAGAGAGTGTAAGG + Intergenic
1110315321 13:74100023-74100045 CCAAGTACACAGAGTGTGGAGGG + Intronic
1112449029 13:99492739-99492761 GAATGTACAAAGAGTGTCTAAGG - Intergenic
1113513611 13:110874340-110874362 GAATGTAGGGGGAATGTGGAGGG - Intergenic
1116435082 14:44887339-44887361 GTGTGGACGCAGGGTGTGGATGG + Intergenic
1121431550 14:93891690-93891712 AAATGTGAGCAGAGTGTGGAAGG - Intergenic
1121798377 14:96754107-96754129 GAGTATACACAGGGTGTGGAAGG + Intergenic
1121993814 14:98586104-98586126 GAATGTACTCAGAGTGAAAAAGG + Intergenic
1123878802 15:24654419-24654441 GAATTTGCCCACAGTGTGGAGGG + Intergenic
1124207313 15:27732550-27732572 GAATGGCAGCAGAGTGTGGAGGG + Intergenic
1134801475 16:17088737-17088759 GAATGTATGCTTAATGTGGATGG - Intergenic
1137816898 16:51406797-51406819 GAATGTACTTAGTGTGTGGTAGG + Intergenic
1144737898 17:17565092-17565114 GGATGGACGCAGAGGGTGGGAGG - Intronic
1146470716 17:33122137-33122159 GAATGGGAGCAGACTGTGGATGG - Intronic
1149535411 17:57429821-57429843 GAATGCGCTCAAAGTGTGGAAGG - Intronic
1153431583 18:5023206-5023228 GAATGTACGAAGGGTGTGTCAGG + Intergenic
1155938346 18:31777472-31777494 GAGTGTACTCAAAGTGTGGTTGG - Intergenic
1160235150 18:77079777-77079799 GAATTTATTCTGAGTGTGGAAGG - Intronic
1161581063 19:5081398-5081420 GAGTGTCCCCAGAGTGGGGAGGG + Intronic
1162152810 19:8657669-8657691 GAATGAAAGCACGGTGTGGAGGG - Intergenic
1163440376 19:17319759-17319781 GTGTGGACGCAGGGTGTGGATGG - Exonic
927366526 2:22303515-22303537 GAATGTCTGCAGAGTCTGCAAGG - Intergenic
931868760 2:66438142-66438164 GGATGTGCACAGAGTGTGTATGG - Intronic
945800823 2:214428100-214428122 AAATGGACGAAGAGTGGGGAAGG + Intronic
1172891222 20:38266941-38266963 GAATGGAGACAGAGAGTGGAAGG + Intronic
1174059233 20:47820927-47820949 GAATATGCACAGGGTGTGGACGG + Intergenic
1175009486 20:55720763-55720785 CAATGTGCCCAGGGTGTGGAGGG + Intergenic
1175400276 20:58696286-58696308 GAATGTGGGCAGAGGCTGGATGG - Intronic
1175842331 20:62036936-62036958 GTGTGTCCTCAGAGTGTGGAAGG - Intronic
1178482939 21:32996026-32996048 GAAGGTCCACAGAGTGTGAAAGG + Intergenic
1178894720 21:36548916-36548938 GAATGTGCCCAGGGTGTGGTGGG - Intronic
1180100682 21:45582907-45582929 GAATGGAAGCAGAGTTTGTAGGG - Intergenic
1184026023 22:41857165-41857187 AAATTAAGGCAGAGTGTGGACGG + Intronic
959442395 3:106393770-106393792 AAATGCAAGCAGAGTGTGTAAGG + Intergenic
965630366 3:170726587-170726609 GAATGTAAGCTGAGTCTAGAGGG - Intronic
966295873 3:178422154-178422176 GGATGTAAGCAGAGTGTGTTGGG - Intronic
967468552 3:189836292-189836314 GAATGTACCCAAAGTGTTGGAGG + Intronic
969272785 4:6114157-6114179 GAATGAATGCAGAGCGAGGAGGG + Intronic
969490339 4:7495979-7496001 GAATGTGGGCCGAGGGTGGAAGG + Intronic
973299528 4:48564533-48564555 TAAGGAAGGCAGAGTGTGGAGGG + Intronic
974094896 4:57351900-57351922 GATTGTGTGCAGAGTGTGTATGG + Intergenic
976362641 4:84197810-84197832 GAATATACGCAGACTGTGTCAGG + Intergenic
976967466 4:91061998-91062020 AAATGTACTAAGATTGTGGATGG - Intronic
979562563 4:122116908-122116930 CAATGGAAGCAGAGTGAGGAAGG + Intergenic
979666171 4:123313194-123313216 GAATGGATGCAGAGGGAGGAGGG - Intronic
980132234 4:128827468-128827490 GAAAGTAAGCAGAGTGTTCAGGG + Intronic
981118254 4:141017401-141017423 GAAAGTAGGAAGAGTGTGTAAGG - Intronic
982270919 4:153587198-153587220 GCATGTCAGCAGAGTGTGGGAGG + Intronic
985131172 4:186740234-186740256 GAATATAGGCAGAGAGTGGATGG - Intergenic
988990015 5:36661572-36661594 GAATCTTTGCAGAGTGTGGGTGG + Intronic
994184462 5:96802963-96802985 GATTCTACCCAGAGTCTGGAGGG + Intronic
995835212 5:116394086-116394108 GAATGTCTGCAGAGTCTGGGGGG + Intronic
1001134267 5:169089552-169089574 GAGTGTAGGCAGAGAGTGCACGG - Intronic
1005995253 6:30926917-30926939 GAATGTACTCTGGGCGTGGAAGG - Intergenic
1008108562 6:47467349-47467371 GAAGGTTGGCAGAGTGTGCAGGG + Intergenic
1010847963 6:80734678-80734700 GAACGTAAGAAGACTGTGGAAGG - Intergenic
1011043776 6:83059726-83059748 GAAACTAAGCAGACTGTGGAGGG + Intronic
1012012504 6:93807074-93807096 GAATCTAAGCAGGGTGAGGAGGG - Intergenic
1016072152 6:139751702-139751724 GAATGAACGCAGAGTGCCCACGG + Intergenic
1016519948 6:144936069-144936091 GAATGGAAGCAGAGGGTGGGAGG - Intergenic
1019892736 7:3959602-3959624 ACATGGATGCAGAGTGTGGAAGG - Intronic
1025235679 7:57233106-57233128 GAATATGCACAGGGTGTGGACGG - Intergenic
1026601488 7:71781299-71781321 GAAAGAACTCAAAGTGTGGACGG - Exonic
1026827138 7:73591530-73591552 GTATGCATGCAGAGAGTGGATGG - Intergenic
1029836312 7:103315267-103315289 GAATGTAGGCAGAGTATACAGGG - Intronic
1031513629 7:122677015-122677037 GAATGTACGCAGAGTGTGGAGGG - Intronic
1032264351 7:130360446-130360468 GAATGTACACAGAGGGTGCAGGG + Intronic
1032743202 7:134760202-134760224 GATTGTACCCTGAGTGTGGTAGG + Intronic
1043406744 8:79943720-79943742 GAATGTATGCAGAGAGGGGAGGG - Intronic
1044649772 8:94481887-94481909 GAATGTAGGGACAGTGTAGAGGG - Intergenic
1048977984 8:139683698-139683720 GTATGTGAGCAGAGTGTGAAGGG + Intronic
1049843550 8:144788953-144788975 GAATGCATGCAGTGTGTGTATGG - Intergenic
1053219101 9:36296671-36296693 GAAGGGAAGCAGAGGGTGGAAGG + Intronic
1059721403 9:116963541-116963563 GGATGTGCACAGAGTGTGGTGGG + Intronic
1060386092 9:123230089-123230111 GAATTTAAGCTGAGTGAGGAAGG + Intronic
1062638798 9:137506219-137506241 GAAAGAAAGCAGGGTGTGGAGGG - Intronic
1203742538 Un_GL000218v1:14717-14739 GAATGTGGGCAGAGGGTAGAGGG + Intergenic
1203567560 Un_KI270744v1:104702-104724 GAATGTAGGCAGAGGATAGAGGG - Intergenic
1185433467 X:23220-23242 GATTGAAAGCAGAGTCTGGAAGG + Intergenic
1185442673 X:235288-235310 GATTGAAAGCAGAGTCTGGAAGG + Intergenic
1186123938 X:6392527-6392549 GGAGGTATGCAGAGTGTGAAAGG - Intergenic
1186758906 X:12702529-12702551 GATTGTAAGCAGGGTGTGGGGGG - Intronic
1190191298 X:48279528-48279550 AAATGTAAGCAGAGGTTGGAGGG - Intergenic
1190200557 X:48357229-48357251 AAATGTAAGCAGAGGTTGGAGGG - Intergenic
1197113702 X:122806269-122806291 AAAAGTAGGCAGAATGTGGAAGG + Intergenic
1197608835 X:128615979-128616001 GCATTTGGGCAGAGTGTGGAGGG + Intergenic