ID: 1031528693

View in Genome Browser
Species Human (GRCh38)
Location 7:122851262-122851284
Sequence GGCCCAGTTGAACATCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 1, 2: 0, 3: 39, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031528693_1031528700 20 Left 1031528693 7:122851262-122851284 CCCCAGGGATGTTCAACTGGGCC 0: 1
1: 1
2: 0
3: 39
4: 203
Right 1031528700 7:122851305-122851327 AAAGTCACTCAATAGAGGACAGG No data
1031528693_1031528702 26 Left 1031528693 7:122851262-122851284 CCCCAGGGATGTTCAACTGGGCC 0: 1
1: 1
2: 0
3: 39
4: 203
Right 1031528702 7:122851311-122851333 ACTCAATAGAGGACAGGAATGGG No data
1031528693_1031528699 15 Left 1031528693 7:122851262-122851284 CCCCAGGGATGTTCAACTGGGCC 0: 1
1: 1
2: 0
3: 39
4: 203
Right 1031528699 7:122851300-122851322 AGCTTAAAGTCACTCAATAGAGG No data
1031528693_1031528701 25 Left 1031528693 7:122851262-122851284 CCCCAGGGATGTTCAACTGGGCC 0: 1
1: 1
2: 0
3: 39
4: 203
Right 1031528701 7:122851310-122851332 CACTCAATAGAGGACAGGAATGG 0: 1
1: 0
2: 0
3: 21
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031528693 Original CRISPR GGCCCAGTTGAACATCCCTG GGG (reversed) Intronic
900202704 1:1418283-1418305 TGCCCCGTGGAGCATCCCTGCGG - Intergenic
900844153 1:5082775-5082797 GGCACAGGTGAGCTTCCCTGTGG + Intergenic
901804856 1:11731998-11732020 GGGCCTGTGGAACGTCCCTGTGG - Intergenic
902097535 1:13958985-13959007 TGCCCTGTTGATCATGCCTGTGG + Intergenic
904130622 1:28272772-28272794 GGACCCGTTGAACAACTCTGGGG + Exonic
904735868 1:32632552-32632574 GGCGCAGTGGCACATGCCTGTGG - Intronic
905062141 1:35149157-35149179 TGCCCTGTGGAACATCCCTGCGG - Intergenic
905421641 1:37850096-37850118 GGCACAGTAGCACATGCCTGTGG + Intronic
905696884 1:39981046-39981068 GGCCCAGGTGGCCATCCGTGTGG + Intergenic
906366598 1:45215346-45215368 GGCCCAGTTGAAGGTATCTGTGG - Intronic
909020929 1:70430318-70430340 GGCCCATTACAACATCACTGTGG - Exonic
909355745 1:74707996-74708018 GGCCCAGTTCATCGTCTCTGTGG - Intronic
910853356 1:91670193-91670215 TGTCCTGTGGAACATCCCTGTGG - Intergenic
911566162 1:99465517-99465539 GGAACACTTGGACATCCCTGTGG + Intergenic
912352581 1:109028322-109028344 GGCCCAGTGGCACATGCCTGTGG - Intronic
912980711 1:114369055-114369077 TGCCCTGTGGAGCATCCCTGTGG - Intergenic
915400359 1:155617418-155617440 GACCCAGAAGATCATCCCTGTGG - Intergenic
916103175 1:161410370-161410392 TGCCCTGTAGAGCATCCCTGCGG - Intergenic
919917672 1:202148757-202148779 GCTCCAGTCAAACATCCCTGTGG + Intronic
921074339 1:211687574-211687596 TGCCCTGTGAAACATCCCTGTGG + Intergenic
921747588 1:218754918-218754940 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
921926940 1:220718577-220718599 TGCCCTGTGGAACATCCCTGAGG + Intergenic
922681059 1:227596175-227596197 TGCCCTGTGGAACATCCCTGCGG - Intronic
922689866 1:227679783-227679805 TGCCTTGTGGAACATCCCTGCGG + Intergenic
922786806 1:228286942-228286964 GGCCCAGCTGCTCATCACTGGGG + Exonic
924859368 1:247905341-247905363 TGCCCTGTGGAACATCCTTGTGG - Intergenic
1062962088 10:1580011-1580033 GTCCAAGTTGTACATTCCTGGGG - Intronic
1063137405 10:3229437-3229459 GGCCCCGTTGCCCACCCCTGAGG - Intergenic
1063572119 10:7225314-7225336 GCCTCTGTTAAACATCCCTGGGG + Intronic
1064187692 10:13177093-13177115 GGCCCACTTGAAGCTCCCTATGG + Intronic
1064855289 10:19760553-19760575 TGCCCAGGTGCACATCCCTGGGG - Intronic
1065930754 10:30476637-30476659 TGCCCTGTGGAACATCCCTGCGG + Intergenic
1068672080 10:59733499-59733521 TGCCCTGTAGAACATCCCTGTGG - Intronic
1069522931 10:69140205-69140227 GGCACAGTGGCACATGCCTGTGG - Intronic
1069938890 10:71939911-71939933 TGCCCTGTGGAGCATCCCTGCGG + Intergenic
1071615536 10:87072131-87072153 GGCACAGTTGCACACCCCTGTGG + Intronic
1071888530 10:89977344-89977366 GGCCCAGGTGAGCTTCTCTGAGG - Intergenic
1072334436 10:94385021-94385043 TGCCCTGTGGAACATCCCTGCGG + Intergenic
1072689327 10:97561231-97561253 TGCCCTGTGGAGCATCCCTGTGG - Intronic
1074360433 10:112820997-112821019 GCCCCAGTCAAACACCCCTGTGG + Intergenic
1075106378 10:119542624-119542646 GGCGCGGTTGAACATCGCCGCGG + Exonic
1075140921 10:119834719-119834741 GGCACAGTGGCACATGCCTGTGG + Intronic
1076039106 10:127227695-127227717 GGAAAAGTTGCACATCCCTGTGG - Intronic
1076044001 10:127275952-127275974 GGCCGCGTTGGAGATCCCTGCGG + Intronic
1076520110 10:131076111-131076133 GGCCCAGGTGGACATCCCAGTGG - Intergenic
1076701532 10:132275677-132275699 GGCCCAGGTCCTCATCCCTGCGG - Intronic
1077589650 11:3481619-3481641 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
1079000911 11:16754684-16754706 GGCCCAGTGGCTCATACCTGTGG - Intronic
1081648607 11:44807811-44807833 GGCCCAGCTGAACATCCCTGTGG + Intronic
1081999865 11:47388354-47388376 GGCCCAGTTGACCCTGGCTGGGG - Intergenic
1082780522 11:57284096-57284118 GCCCTAGTAGAACATCTCTGTGG - Intergenic
1082818172 11:57524490-57524512 GGCACAGTGGCACATGCCTGTGG - Intergenic
1083082473 11:60108433-60108455 TGCCCTGTGGAACATCCCTGTGG - Intergenic
1083265711 11:61546033-61546055 GGACAAGTTGAGCTTCCCTGCGG + Exonic
1083342708 11:61968530-61968552 GGCCCTGTAGGACAACCCTGGGG + Intergenic
1084827317 11:71741185-71741207 TGCCCTGTGGAGCATCCCTGAGG + Intergenic
1084977878 11:72813333-72813355 GGCAGACTTGAACATCCCTAGGG - Intergenic
1085998544 11:81951763-81951785 TGCCCTGTGGAACATCCCTGCGG + Intergenic
1086973758 11:93110325-93110347 TGCCCTGTGGAGCATCCCTGTGG - Intergenic
1089429125 11:118406717-118406739 TGCCTGATTGAACATCCCTGTGG + Intronic
1090041674 11:123297757-123297779 GGCACAGTGGCACATGCCTGTGG - Intergenic
1091039490 11:132263203-132263225 GGCCCCCTTGAACAGCCTTGGGG - Intronic
1091814853 12:3429879-3429901 TGCCCTGTGGAGCATCCCTGTGG - Intronic
1092415940 12:8290525-8290547 TGCCCTGTGGAGCATCCCTGAGG - Intergenic
1092436345 12:8449422-8449444 TGTCCTGTGGAACATCCCTGCGG - Intergenic
1095838820 12:46669584-46669606 GGCCCAGTAGAGTATCTCTGGGG + Intergenic
1096207404 12:49734524-49734546 TGCCCTGTGGAACATCCCTGTGG + Intronic
1096306172 12:50479203-50479225 GACACAGTTGAACAACACTGGGG + Exonic
1100835143 12:98559940-98559962 GGGCCAATTGAATATCCCTATGG + Intergenic
1104033532 12:125082309-125082331 GGCACAGTGGCACATACCTGTGG - Intronic
1104418898 12:128618881-128618903 GGTCAAGTTGTACATCCCAGGGG - Intronic
1104908398 12:132227860-132227882 TGTCCATTTGCACATCCCTGTGG - Intronic
1107914465 13:45135091-45135113 GGCGCAGTGGCACATGCCTGTGG - Intronic
1109802378 13:67397787-67397809 TGCCCTGTGGAGCATCCCTGCGG + Intergenic
1118282240 14:64440125-64440147 GGCCCAGTTTGATATCTCTGTGG + Exonic
1119407339 14:74407076-74407098 TCCCCAGGTGAAGATCCCTGTGG + Exonic
1125921636 15:43528773-43528795 GGCTCAGTGGCACATCCCTGGGG - Exonic
1126409192 15:48354457-48354479 TGCCCATTTTAAAATCCCTGTGG + Intergenic
1128080452 15:64854086-64854108 GGACCAGTTGACCACCACTGAGG + Intronic
1130330556 15:82918833-82918855 GGCCGAGTTCAACACACCTGTGG - Intronic
1131885014 15:96903110-96903132 GGCCCATTTTAACATTCCTGGGG + Intergenic
1133179429 16:4041889-4041911 GGGGCAGTGGCACATCCCTGAGG - Intronic
1135184975 16:20307583-20307605 AGCCCAGCTGAACAGCACTGGGG + Intergenic
1136052543 16:27662425-27662447 TGTCCAGTTGGTCATCCCTGGGG - Intronic
1136394888 16:29987383-29987405 GGCCCAGGGGAACACCCATGAGG - Exonic
1136532651 16:30880016-30880038 GGCGCAGTAGCACATGCCTGTGG + Intronic
1137041899 16:35620806-35620828 TGCCCTGTGGAACATCCCTGTGG - Intergenic
1141143050 16:81509753-81509775 GCCCCAGCTGCACATCCTTGGGG + Intronic
1141366677 16:83450023-83450045 GGCCCAGCTGCTCATCACTGGGG + Intronic
1143658665 17:8311929-8311951 GCCCCAGTTTACCCTCCCTGTGG + Intronic
1145865512 17:28238746-28238768 TGCCCTGTGGAGCATCCCTGTGG - Intergenic
1147692399 17:42324633-42324655 GGCCCAAATGAACAGCCCTATGG + Intronic
1148829286 17:50419911-50419933 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
1149251585 17:54776612-54776634 GGAAGAGTTGAACATGCCTGTGG - Intergenic
1149476500 17:56965490-56965512 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
1150725596 17:67649012-67649034 GGCCCAGTGGCACATGCCTGTGG + Intronic
1151578078 17:74962882-74962904 GGGCCAGTTGAAGTTCCCTTGGG - Intronic
1152453382 17:80397854-80397876 TGCCCTGTGGAGCATCCCTGTGG + Exonic
1153830070 18:8914182-8914204 TGCCCTGTGGAGCATCCCTGAGG + Intergenic
1154009648 18:10564144-10564166 GGCTCAGCTCAGCATCCCTGAGG + Intergenic
1154014368 18:10603641-10603663 TGCCCTGTGGAACATCCCTGCGG - Intergenic
1155529561 18:26752847-26752869 GGCACAGTGGCACATTCCTGTGG - Intergenic
1157047950 18:44125259-44125281 GGCACAGTGGAACACACCTGTGG - Intergenic
1157823304 18:50789745-50789767 GGCCCAGTGGCACATGCCTATGG - Intergenic
1160538826 18:79609736-79609758 GGCCCAGTTGTTCATCACAGGGG - Intergenic
1162281613 19:9702640-9702662 TGCCCTGTGGAACATCCCTGAGG + Intergenic
1163756015 19:19106472-19106494 GGCCCAGATGCAAACCCCTGGGG - Intronic
1163867413 19:19785702-19785724 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
1163991497 19:21002916-21002938 TGCCCTGTGGAGCATCCCTGCGG + Intergenic
1164131035 19:22362024-22362046 TGCCCTGTGGAGCATCCCTGTGG - Intergenic
1165044556 19:33094448-33094470 GGCGCAGTGGCACATGCCTGTGG - Intronic
926823790 2:16882174-16882196 AGAACAGTGGAACATCCCTGAGG - Intergenic
927192253 2:20524751-20524773 GGTCCACTTGAATATCCCTCTGG - Intergenic
927897477 2:26793222-26793244 GGGCCAGTTGCACATCCTTTGGG - Exonic
934614461 2:95762655-95762677 AGCCCAGATGTACTTCCCTGGGG - Intergenic
934646444 2:96061844-96061866 AGCCCAGATGTACTTCCCTGGGG + Intergenic
935970300 2:108524430-108524452 TGCCCTGTGGAACATCCCTGCGG + Intergenic
936419882 2:112353447-112353469 TGCCCTGTGGAACATCCCTGCGG - Intergenic
936675415 2:114708611-114708633 GGCTCAGGTGTACATCACTGTGG + Intronic
938717980 2:134038490-134038512 GGCACAGTGGCACATCTCTGTGG + Intergenic
942126761 2:172833840-172833862 GCCCCAGTTACACATCCCTAAGG + Intronic
946280247 2:218661083-218661105 GGCCCAGTTGGACACCCTTCCGG - Exonic
947594329 2:231401279-231401301 TGCCCTGTGGAGCATCCCTGCGG + Intergenic
947910234 2:233795887-233795909 AGCCCAGCTGACCATACCTGGGG - Intronic
948471106 2:238180029-238180051 GGCACAGTGGCACATGCCTGTGG + Intronic
948692849 2:239717835-239717857 GGCCCAGCTGACTATCGCTGCGG + Intergenic
1171113158 20:22502333-22502355 TGCACAGTGGAACATCCCTGGGG + Intergenic
1171407251 20:24919801-24919823 TGCCCTGTGGAGCATCCCTGCGG + Intergenic
1173903746 20:46610668-46610690 GTCCCAGTTTGCCATCCCTGAGG + Intronic
1175514169 20:59558333-59558355 TGCCCTGTGGAACATCCCTGCGG - Intergenic
1175515329 20:59566357-59566379 GGCCATGTTGACCACCCCTGAGG + Intergenic
1176300239 21:5095818-5095840 GGCCAAGTTCAACATCCAGGGGG + Intergenic
1177355401 21:19999627-19999649 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
1178447578 21:32659899-32659921 TGCCCTGTGGCACATCCCTGTGG + Intronic
1179100631 21:38352864-38352886 GGACCAGCTGAACCTACCTGGGG - Intergenic
1179669018 21:42932503-42932525 TGCCCTGTGGAACATCCCTGCGG + Intergenic
1179856783 21:44166093-44166115 GGCCAAGTTCAACATCCAGGGGG - Intergenic
1180314987 22:11270349-11270371 GGCACAGTGGCACATGCCTGTGG + Intergenic
1181580474 22:23825218-23825240 GCCTCAGCTGAACATCCATGTGG + Exonic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1182286688 22:29252724-29252746 AGCCCAGTGCCACATCCCTGGGG + Intronic
1182816219 22:33166393-33166415 GTGCCAGGTGAACATCCCTGTGG - Intronic
1182816226 22:33166433-33166455 GGTGCAGATGAACATCCCCGTGG - Intronic
1184382988 22:44157795-44157817 GGCTCAGGTGATCCTCCCTGAGG - Intronic
1184550937 22:45203807-45203829 GGCCCAGAAGAACACCCGTGAGG + Intronic
949368273 3:3306727-3306749 TACCCAGTTGAGCATCCCTTTGG - Intergenic
949991050 3:9579489-9579511 GGCACAGTGGCACATGCCTGTGG + Intergenic
950629492 3:14272827-14272849 GGCTCAGGTGATCCTCCCTGTGG + Intergenic
951166619 3:19490135-19490157 TGCCCTGTGGAGCATCCCTGCGG - Intronic
956995867 3:74825577-74825599 TGCCCTGTGGAGCATCCCTGAGG + Intergenic
958000258 3:87740799-87740821 TGCCCTGTGGAACAACCCTGAGG - Intergenic
958483967 3:94679605-94679627 GACCCAGTTTCACATGCCTGGGG - Intergenic
960687833 3:120311988-120312010 TGCCCAGTGGAGCATCCCTGTGG + Intergenic
961243415 3:125431732-125431754 GCCCCAGTTGAAGAGACCTGGGG + Intergenic
961580588 3:127878125-127878147 GGCACAGTGGTACATGCCTGTGG - Intergenic
961609217 3:128123444-128123466 GGCCCATTTTCACTTCCCTGAGG + Intronic
961893491 3:130149138-130149160 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
962096188 3:132295506-132295528 CGCCCTGTGGAGCATCCCTGCGG + Intergenic
962868102 3:139464511-139464533 GGCCGAGTTGAACCTCACTTTGG + Intronic
964523043 3:157587453-157587475 TGCCCTGTGGAGCATCCCTGTGG - Intronic
965911605 3:173784424-173784446 GTCCCTGTTGAGCATGCCTGTGG - Intronic
968527481 4:1069610-1069632 GACTAAGGTGAACATCCCTGTGG + Intronic
969646712 4:8434454-8434476 TGCCCTGTAGAGCATCCCTGTGG + Intronic
969749281 4:9097987-9098009 TGCCCTGTGGAGCATCCCTGCGG + Intergenic
970374446 4:15442471-15442493 AGCACAGATGAACTTCCCTGTGG - Exonic
971683358 4:29731531-29731553 GGCCAAGTTGAACATTTCTAAGG - Intergenic
972216720 4:36906260-36906282 TGCCCTGTGGAACATCCCTGCGG + Intergenic
972874048 4:43336710-43336732 GTCCTAGTTCATCATCCCTGAGG + Intergenic
974949991 4:68576121-68576143 TGCCCTGTGGAGCATCCCTGTGG - Intronic
976990480 4:91358861-91358883 TGCCCTGTGGAGCATCCCTGAGG - Intronic
977043940 4:92045965-92045987 TGCCCTGTGGAGCATCCCTGTGG - Intergenic
979377643 4:119965851-119965873 GGCACAGTGGCACATACCTGTGG - Intergenic
981547401 4:145908417-145908439 GTACCAGGTGAACATACCTGTGG - Intronic
981604342 4:146526431-146526453 TGCCCTGTGGAACATCCCTGCGG + Intergenic
983897665 4:173099214-173099236 TGCCCTGTGGAACATCCCTGCGG + Intergenic
986172344 5:5325070-5325092 GGCCCATTTGACCCTCCCTTGGG + Intergenic
986418756 5:7555161-7555183 GGCCCTGTTGAATCTGCCTGTGG + Intronic
990073305 5:51811905-51811927 GGCCTAGTTGAAAATCCATTTGG - Intergenic
991695163 5:69264403-69264425 GGCACAGTGGTACATACCTGTGG + Intronic
992387689 5:76301540-76301562 GGCCCATTTCAACATACCTCCGG - Exonic
992499240 5:77325305-77325327 GGCACAGTAGCACATGCCTGTGG - Intronic
993869686 5:93237784-93237806 GGCACAGTTGCATATGCCTGTGG - Intergenic
998114582 5:139526419-139526441 TGCCCTGTGGAGCATCCCTGTGG + Intronic
998151287 5:139758929-139758951 GGCCCAGCAGAACCTCCCAGCGG - Intergenic
998436580 5:142114974-142114996 GGCCCAGTTGAACTGCTCTAGGG + Intronic
1006032320 6:31186196-31186218 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
1006570442 6:34998908-34998930 TGCCCTGTGGAACATCCCTGCGG + Intronic
1008122623 6:47635289-47635311 TGCCCTGTGGAACATCCCTGTGG + Intergenic
1011564697 6:88662665-88662687 TGCCCTGTGGAGCATCCCTGGGG + Intronic
1012590922 6:100979539-100979561 GGCCCAGATGAACAGCACAGAGG - Intergenic
1013559458 6:111290050-111290072 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
1015890833 6:137968102-137968124 GTCCCAGTCCAATATCCCTGCGG + Intergenic
1018715828 6:166532230-166532252 GGCCCAAGTGAGCATCCGTGTGG + Intronic
1020323713 7:6958653-6958675 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
1021562328 7:21980970-21980992 AGCCCAGTTCACCTTCCCTGTGG - Intergenic
1021849653 7:24795256-24795278 TGCCTTGTGGAACATCCCTGCGG - Intergenic
1022838105 7:34136107-34136129 GCCCCAGTTTGGCATCCCTGTGG - Intronic
1026928897 7:74212081-74212103 GGCGCAGTGGCACATGCCTGTGG - Intronic
1029485809 7:100839535-100839557 TGCCGTGTGGAACATCCCTGCGG + Intronic
1029821707 7:103152880-103152902 TGTCCTGTGGAACATCCCTGTGG + Intergenic
1031528693 7:122851262-122851284 GGCCCAGTTGAACATCCCTGGGG - Intronic
1032513971 7:132493432-132493454 AGCCCATTTGGACAACCCTGTGG + Intronic
1032979773 7:137268257-137268279 TGCCCTGTGGAACATCCCTGCGG - Intronic
1036372349 8:8172330-8172352 TGCCCTGTGGAGCATCCCTGCGG + Intergenic
1036817272 8:11911531-11911553 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
1036878553 8:12493311-12493333 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
1038089339 8:24236030-24236052 TGCCCTGTGGAGCATCCCTGCGG + Intergenic
1038798460 8:30729152-30729174 TGCCCTGTGGAGCATCCCTGCGG + Intergenic
1039877163 8:41596670-41596692 TGCCCTGTGGAGCATCCCTGCGG - Intronic
1040835658 8:51728460-51728482 GTCCCAGTAGAACATCTTTGGGG - Intronic
1041226596 8:55706618-55706640 TGCCCTGTGGAACATCCCTGTGG + Intronic
1041515104 8:58691391-58691413 TGCCCTGTGGAACATCCCTACGG + Intergenic
1043532452 8:81166036-81166058 GTCCCATTTGAACTTCCCTCTGG - Intergenic
1045140403 8:99274327-99274349 GGTCCAGCTGCACATACCTGGGG - Exonic
1047162826 8:122400165-122400187 GGGCTAGTTTAACATCTCTGAGG - Intergenic
1047248472 8:123164335-123164357 GGCCAAGTTCAACATTACTGGGG + Intergenic
1048060473 8:130914731-130914753 GGCACAGCAAAACATCCCTGGGG - Intronic
1057096686 9:92317090-92317112 GGCCCGGTGGCACATGCCTGTGG - Intronic
1057374029 9:94502168-94502190 GGCATAGTTGTACAGCCCTGTGG - Intergenic
1059201466 9:112421185-112421207 GGCACAGTGGAGCATGCCTGTGG + Intronic
1060323520 9:122589962-122589984 GGGCCAGTTGAATATCCATTTGG - Intergenic
1061404472 9:130385756-130385778 AGCCCAGGTGAGCAACCCTGGGG + Intronic
1062224841 9:135444046-135444068 TGCCCTGTGGAGCATCCCTGCGG - Intergenic
1062437771 9:136554238-136554260 GGCCCTGTGGACCAACCCTGGGG + Intergenic
1062444196 9:136586876-136586898 GGCCCAGGTGAGCCTCCCGGAGG + Intergenic
1062657459 9:137611703-137611725 GGCCCAGTCCCCCATCCCTGAGG - Intronic
1185909182 X:3966388-3966410 TGCCCCGTGGAGCATCCCTGTGG + Intergenic
1186558917 X:10589758-10589780 TGCCCTGTGGAACATCCCTGCGG - Intronic
1188282031 X:28282111-28282133 TGCCCAGTTGAACAGCCAGGTGG + Intergenic
1190426478 X:50338163-50338185 TGCCCTGTGGAGCATCCCTGTGG - Intronic
1190630606 X:52381631-52381653 AGCCCATTCGAACATCCATGGGG - Intergenic
1190708924 X:53051296-53051318 GGCCCAGAAGACCATCTCTGTGG + Intronic
1191638940 X:63409575-63409597 TGCCCTGTGGAACATCCCTGCGG + Intergenic
1191918286 X:66225745-66225767 TGCCCTGTGGAGCATCCCTGCGG - Intronic
1192856813 X:75020759-75020781 GGCACAGTTGCACATGCCTGTGG - Intergenic
1193521903 X:82540971-82540993 GGCCCAATTGAACATCTCATAGG + Intergenic
1194069968 X:89310461-89310483 GGCACAGTGGCACATCCCTGTGG - Intergenic
1195243124 X:102972744-102972766 GCCCCAGTTGGAACTCCCTGTGG - Intergenic
1197706642 X:129639103-129639125 GGGCCAGGAGAACATCCCTGGGG + Intergenic
1198469857 X:136936074-136936096 TGCCCTGTAGAGCATCCCTGTGG - Intergenic
1198568090 X:137925824-137925846 GGCCCAGCTCAAAATCTCTGGGG - Intergenic
1198969448 X:142265703-142265725 TGCCCTGTGGAGCATCCCTGTGG + Intergenic
1200724208 Y:6646096-6646118 GGCACAGTGGCACATCCCTGTGG - Intergenic
1200942809 Y:8803533-8803555 TGCCCTGTGGAGCATCCCTGTGG + Intergenic